Transcript

histh1l-201

ID
ZDB-TSCRIPT-090929-4588
Name
histh1l-201
Previous Names
  • histh1l-001
  • zgc:110380-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019822 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019822|OTTDARG00000016486|ZDB-GENE-050417-145 histh1l|OTTDARP00000016752 DKEYP-38H2.1-001 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 1394 bp
CCGCCCTCAGCTGTTGGATGTAAACATTGTTTGTTTGACA
GCTCTGTACTACGTGACATCGGATCCAAGTTTACTACAAC
TATGGCAGAAACTGCTCCTGCTCCCGCGGCGGCTCCGGCC
AAATCTCCGAGGAAGAAGGCGACAAAGGCGAAAAAGCCCG
GACCCAGCGTGTCAGACCTCATCGTGAAGGCGGTTGCTGC
TTCCAACGAGCGCAAAGGAGTTTCCCTAGCGGCTCTGAAG
AAGGCTTTGGCAGGTGGTGGATATGACGTCGAGAAGAACA
ACTCTCGCGTCAAGATCGCCCTGAAAGCTTTGGTGAAAAG
GGGGGCGCTTGTCCAGACCAAAGGCACCGGAGCGTCCGGA
TCCTTCAAGGTGAGCAAGAAAGCAGCCGCCAAGAAACCCG
CCAAGAAAGTTGTGGCGAAGCCGAAGAAGCCAGTCGTCAA
GAAGAAGAAGGCGGCGGCCAAGGTGGCAAAGCCCAAGAAG
GCAGCAGTAAAGAAAGCCTCCCCGAAGAAGTCTCCTAAGA
AAGTGAAGAAACCGGCTGCCAAGAAAGTCGCCAAAAGCCC
AAAGAAAGTGAAGAAGCCGGCTGTGAAGAAAGTTGCAAAG
AGTCCTAAGAAGGTCAAAGCAGTGAAACCTAAAGCTGCAA
AGCCCAAGGCTGCCAAGGCGAAGAAGACGGCCGCCAAGAA
GAAGTAGACTGAAAGACTTACTCCAAAAACCAAAGGCTCT
TGTAAGAGCCACCCCATCTTCACAGAAGTGCACATGTTCC
TAATGCATGTAAGAAGGCGAATGCTTGTTTAATAGACTGA
GAACATTTTCTTTTTTACTCGGGATGTGACTGTATAAACG
GTCCTGATTCTACTGCTTCCATCATCACCAGCGGGAACGA
GCAGCACACAATGCTGTGGAGGACTTTTGTGTTGTTTGTT
ATTTTCAAGATCGGTTTGTGAAAACACATGACAGTCTCTA
CCTCTGTACCTGATACACAAAGCCGATTACTCGGTGTAGA
TTTTCAGTCCTTCAGAGATTAGGCAGAAGAGTCCGCTGGT
TGGAAAGTGTCCAATATGTCCATACATTAACATAAGTTCA
TCTTGTGCGCGCGCGCGTATGTAACTAAACTGGATGAATG
TGTTTTATCACTATGATTCATGTTATATTTATATTTTGTA
TTGGATTAAATGAGACTTTCCTGTAAATATACAGCAATAC
AGAACAATTAATTTATTCATTGTCGAGTGTTGTTTTTTTG
AATGTTTCTACCAGAGGTAAACACATTCCATTAATAAACT
TGTTTTTTGTTTTGTTTTGCTTTTGTATTGTTCTTAACAT
TTATTCATAAACCTATATTTTGTCCAAAATGTGTTTTAGT
ATAAAAATCCTAATAAAAACAAATACAATATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations