ZFIN ID: ZDB-TSCRIPT-090929-4588
Transcript Name: histh1l-201
Previous Names: histh1l-001, zgc:110380-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019822 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019822|OTTDARG00000016486|ZDB-GENE-050417-145 histh1l|OTTDARP00000016752 DKEYP-38H2.1-001 LG_ BX323062.10 Danio rerio protein_coding NOVEL, 1394 bp
CCGCCCTCAGCTGTTGGATGTAAACATTGTTTGTTTGACA
GCTCTGTACTACGTGACATCGGATCCAAGTTTACTACAAC
TATGGCAGAAACTGCTCCTGCTCCCGCGGCGGCTCCGGCC
AAATCTCCGAGGAAGAAGGCGACAAAGGCGAAAAAGCCCG
GACCCAGCGTGTCAGACCTCATCGTGAAGGCGGTTGCTGC
TTCCAACGAGCGCAAAGGAGTTTCCCTAGCGGCTCTGAAG
AAGGCTTTGGCAGGTGGTGGATATGACGTCGAGAAGAACA
ACTCTCGCGTCAAGATCGCCCTGAAAGCTTTGGTGAAAAG
GGGGGCGCTTGTCCAGACCAAAGGCACCGGAGCGTCCGGA
TCCTTCAAGGTGAGCAAGAAAGCAGCCGCCAAGAAACCCG
CCAAGAAAGTTGTGGCGAAGCCGAAGAAGCCAGTCGTCAA
GAAGAAGAAGGCGGCGGCCAAGGTGGCAAAGCCCAAGAAG
GCAGCAGTAAAGAAAGCCTCCCCGAAGAAGTCTCCTAAGA
AAGTGAAGAAACCGGCTGCCAAGAAAGTCGCCAAAAGCCC
AAAGAAAGTGAAGAAGCCGGCTGTGAAGAAAGTTGCAAAG
AGTCCTAAGAAGGTCAAAGCAGTGAAACCTAAAGCTGCAA
AGCCCAAGGCTGCCAAGGCGAAGAAGACGGCCGCCAAGAA
GAAGTAGACTGAAAGACTTACTCCAAAAACCAAAGGCTCT
TGTAAGAGCCACCCCATCTTCACAGAAGTGCACATGTTCC
TAATGCATGTAAGAAGGCGAATGCTTGTTTAATAGACTGA
GAACATTTTCTTTTTTACTCGGGATGTGACTGTATAAACG
GTCCTGATTCTACTGCTTCCATCATCACCAGCGGGAACGA
GCAGCACACAATGCTGTGGAGGACTTTTGTGTTGTTTGTT
ATTTTCAAGATCGGTTTGTGAAAACACATGACAGTCTCTA
CCTCTGTACCTGATACACAAAGCCGATTACTCGGTGTAGA
TTTTCAGTCCTTCAGAGATTAGGCAGAAGAGTCCGCTGGT
TGGAAAGTGTCCAATATGTCCATACATTAACATAAGTTCA
TCTTGTGCGCGCGCGCGTATGTAACTAAACTGGATGAATG
TGTTTTATCACTATGATTCATGTTATATTTATATTTTGTA
TTGGATTAAATGAGACTTTCCTGTAAATATACAGCAATAC
AGAACAATTAATTTATTCATTGTCGAGTGTTGTTTTTTTG
AATGTTTCTACCAGAGGTAAACACATTCCATTAATAAACT
TGTTTTTTGTTTTGTTTTGCTTTTGTATTGTTCTTAACAT
TTATTCATAAACCTATATTTTGTCCAAAATGTGTTTTAGT
ATAAAAATCCTAATAAAAACAAATACAATATCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
histh1l-201 Contained in:
[BAC] DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000019822 (1),  Ensembl_Trans:ENSDART00000124705 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN018606 (1) 932 nt
GenBank:CK017499 (1) 870 nt
GenBank:CK867943 (1) 819 nt
GenBank:CN172813 (1) 817 nt
GenBank:CN013670 (1) 777 nt
GenBank:AI588108 (1) 488 nt
CITATIONS (2)