ZFIN ID: ZDB-TSCRIPT-090929-4580
Transcript Name: slc4a5a-202
Previous Names: si:ch211-48m9.1-001, si:ch211-48m9.1-202 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019796 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019796|OTTDARG00000016462|ZDB-GENE-060531-64 si:ch211-48m9.1|OTTDARP00000016727 CH211-48M9.1-001 LG_ BX936413.10 Danio rerio protein_coding NOVEL, 3050 bp
ACCATCAGTCCATCTACATTGGTGTGCCAGTGCCTCGCGG
TTACCGTCGCAAACGCAGACGGAGACGTTCATCCATGTCA
AGTCGTGATGCAGATGTAGATCGAAGACTTCGACATGATC
ATCACAGACATGAACACTACGAATGTGATGACAGAGACCG
CTATGATCTGGAGGCGGGAGGCCTGGATCAAGCAGAACAC
AACTTGCCACCAGACATCAACAGAACCATGTCCCCGGCGG
CTGAGCGGCTGCGCTATATTTTGGGGGACGATGAGGAGAC
CATGCCCACACCCACTCTCTTTACTGAGATGGACACATTG
CAGCATGAGGGAGACGAGCTGGAGTGGGTGAAGTTTGAGG
AAAAAGTTGAGGAGGGTGGAGAAAGATGGAGCAAACCACA
CGTTTCCACACTGTCCCTGCACAGCCTGTTTGAACTGCGG
ACATGCCTGCAGACCGGCACCGTGCTGCTGGACCTGGAGG
GATACTCGCTCCCACAGATCGTCGATGACATCATCGATCG
TCAGGTAGAGGAAGGGTTGATCGGTCCTGAATTGAGAGAC
AAAATCAGCTTTGTACTGCTGAGAAAGCACAGACACCAGA
CCAAAAAGCCCATCCATCGCTCCCTTGCGGATTTGGGCAA
GTCTGGTTCAGGAGGCACTCGGAGTCCTGCCCGAACCCCT
GCTGCCCAGGCAGCAAATTTTAACCGCTCTACTGAAGATC
TGCGCACTAAACAAGCAGCAAACTATGGAAGACTACGCCA
CGCTCAAAGCAGGAGTATGAATGACATCGCCGACACACCA
AGCACAGACCAGCTAAAGAACAAGTTCATGAAGAAAATCC
CCAGAGATGCAGAAGCATCCAATGTTCTGGTGGGAGAAGT
GGACTTCTTAGAAAAACCCTTCGTTGCCTTCGTTCGTCTG
TCTCAGGCCACCACTCTTGGAGGCCTGACAGAAGTCCCAG
TGCCCACCAGATTCTTGTTTGTGCTACTTGGGCCTCCTGG
CAAAGCCAAATCTTATAATGAGATCGGACGTGCCATTGCC
ACTCTCATGGTGGATGATCTCTTCAGTGATGTAGCATATA
AAGCCAGAGACAGGGAGGACCTGATTGCAGGCATTGACGA
GTTCCTGGACGAGGTGATTGTGCTTCCACCTGGAGAGTGG
GACCCCAAAATTCGCATAGAGCCCCCCAAAAAAACTCCCT
CAGCAGACAAAAGAAGGAAATCTGTATTTTCCCTCAATGA
GCTGGGTCAGATGAACGGGACGGCAGGAGGCGGAGGGCCT
ATTGAAGAGGATGAAGAGATGCCTGTTCCACATGAGCTCG
GCGAAGAGTTGGCTTACACAGGGAGGTTCTGTGGCGGCCT
TTTTCTTGACATGAAGCGGAAGCTCCCCTGGTACCCGAGT
GACTTTTATGAAGGTTTCCACATTCAGTCTATCTCCGCGG
TGCTCTTCATCTACCTGGGCTGCATAACCAATGCAATCAC
CTTTGGGGGCCTTCTAGGGGATGCCACAGACAATTACCAG
GGTGTAATGGAGAGTTTTTTGGGCACCGCTTTAGCAGGAA
CAGTATTCTGCGTTTTTGGCGGTCAACCCCTCATTATTCT
CAGCTCAACAGGGCCCATCCTCATCTTCGAGAAACTGCTT
TATGAATTCAGCAAAAATAATGCGATTGATTACATGGAGC
TCCGGCTGTGGATCGGCATTCACTCCTGCATTCAGTGCTT
TATCCTGGTGGCCACGGATGCCAGTTACATCATAAAGTAC
ATGACGCGCTTTACGGAGGAGGGCTTCTCTAGTCTCATCT
CCTTCATCTTCATCTCTGACGCCATCAAGAAGATGGTGGG
CTCCTTTAAATATTACCCCATCAACACTGACTTCAAGCCG
GACTACGTTACGGCCTACAAGTGCGAGTGTGTGGCACCAG
ACCCGACTCTGGACTGGACTCAGTTGAGTAAGAAGGAGTG
TGTGAAGTACGGAGGCTCACTGGTGGGACAGTCCTGCAAA
TATGTTCCAGATCTTGCTCTAATGTCCTTCATTTTGTTCT
GCGGCACTTACACCATGACTGTCACTCTGAAGAAGTTCAA
ATTTAGTCGCTACTTTCCCACTAAGTTGAGGAAGTTAATT
AGTGACTTCTCCATCTTCATGTCCATCATGACGTTTGTGG
GTCTGGACATGCTAATAGGTTTGAAAACACCCAAACTCAT
TGTGCCTACCGAGTTCAAGCCCACACGTCCTGACCGAGGA
TGGTTTGTGATGCCATTTGGAAAGAATCCATGGTGGGTTT
ACCTGGCAAGCTTCGTCCCTGCTCTCCTCGTCACCATCCT
TATCTTCATGGATCAGCAGATCAGCGCTGTTATCGTCAAC
CGGAAGGAAAACAAGTTAAAGAAAGGCTGTGGGTATCATC
TGGATCTATTGTGGGTTGGCGTTCTGATGGCAGCCTGCTC
TTTTATGGGTCTGCCGTGGTATGTTGCGGCCACTGTCATT
TCCATCGCTCACATTGATTCACTGAAGATGGAGAGCGAGT
CTAGTGCTCCAGGGGAACAGCCACAGTTCTTGGGTGTGAG
GGAACAAAGACTGACAGGAATCCTGGTCTTTGTGCTGACA
GGAGTGTCTATTTTCTTGGCCCCGATCCTGCAGTTCATCC
CTATGCCAGTCTTGTATGGAGTTTTCCTCTACATGGGCGT
TGCTTCTCTCAGTGGCATCCAATTCTGGGACAGAATTAAA
CTGATCATGATGCCAGCGAAACACCAGCCAGACTTTTCAT
ACCTGCGTCATGTGCCGCTCAGGAGAGTCCATCTATTCAC
ACTGGTGCAGATTGTGTGCTTAGCAGTACTCTGGATCCTC
AAATCTACTTTCCTCGCCATCATCTTCCCTGTCATGATTC
TAGGTCTCATGGTGGTCCGAAAGATGTTAGACATGGTCTT
CTCTCAACATGATCTGGCATGGCTGGACGATATCCTGCCT
GAGAAGGAAAAGAAGAAAAAAGATGATGAAAAGAAGAACA
TCAAGAAGGACAAAAAGAAAGGCAAAGGAGGGGATGACAG
TGAAGATGAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc4a5a-202 Contained in:
[BAC] CH211-48M9 (1)

Genome Resources: Vega_Trans:OTTDART00000019796 (1),  Ensembl_Trans:ENSDART00000138140 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (3)