Transcript

ccnh-202

ID
ZDB-TSCRIPT-090929-4566
Name
ccnh-202
Previous Names
  • ccnh-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019753 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019753|OTTDARG00000016429|ZDB-GENE-050320-13 ccnh|OTTDARP00000016687 DKEY-195M1.2-001 LG_ BX470189.5 Danio rerio protein_coding KNOWN, 1285 bp
AAGTGGCGTGTATCGCATGCGACGCTTTCTTGCGTGTTTA
GATAACGTACGTTTATAATCGTGAAACTTTTGAGTGCGAT
ACGCAGCTTTTCGTCTTGTATAATAGTTGATGTTTGTACG
ACTAGACTTGATTTAAGAAACATCATCGTGTGCATTAGGG
ATGTATCACAACAGCTCACAGAAGAAATTCTGGACATATG
ATAAAGAGGAAACTTTGGATAAATTAAGACTTGAAGCTAA
TCAGAAGTTCTGCTCAAAAGCTCTGTCCAGTGGAAAGCCT
GGAATAAATGAATCCACACTTCTCAATGAGCAGGAAGAGA
AAGTGCTTTTCAAACACTATGAGAAGAGATTGCTAGACTT
TTGTGCTGTGTTTAAGCCTGTGATGCCTAAATCTGTTGTG
GGCACAGCTTGCATGTATTTTCGAAGATTCTATTTGAACA
ACTCATTAATGGAGTATCATCCTCGGACAATAATGTTGAC
ATGTGCATATCTGTCCTGTAAAGTGGATGAGTTTAATGTG
TCCAGCACTCAGTTTGTGGGGAATCTTCAGGAGAGCCCAG
CGGGACAGGAGAGAGCTGTAGATCAGATTCTGGAGTATGA
ACTGCTCCTTATCCAGCAGCTGAATTTTCATCTGGTCGTT
CACAATCCGTATCGACCTTTGGAGGGTTTTCTGATTGATC
TGAAGACCAGGTACCCATTGTTAGAGAACCCAGAGATGCT
TAGAAAAAGTGCTGAAGACTTTCTCAACCGAGCAACAATG
ACAGATGCCGGACTGCTCTTCTCTCCATCTCAGATTGCTC
TCACTGCTGTCCTCAATAGCGCTGCACGTGCTGGCCTCAA
GATGGATGTATATTTAAATGAATGTATGGGGCTTAAGGAG
GATAAAGAGACCCTCTCAAAGATGTATGAGTCAATGAGAC
GAATGACAAGTCTTGTTAAAGCGTACGAGCTTCCCAAAGC
TGAGGAAGTCAGTATCTGCAAACAGAAACTGGAAAGGATT
TATGCTGAGTTTGCTACAAACCTGAAAAGAAAACATGGAT
ATGAAGATGACGATCACGTTGTGAAAAGGCAGATGGTTGC
AGATGAAGAGTGGACTGATGATGATTTGGATGCATTGTGA
TAAGTAAATGACTTTAAACTGGCAGCAGAGATTTTCAAGA
ACAGGTCGAGTGATTCCATCTGGTAACAGGAGAGGATGAG
CTTCTCATTATTAAATTGTAAATATTTCAGTAAAATGATG
TGTAAATCTTTTAGTAATGTGAAAATAAATCTTTCTTTTT
TTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations