Transcript

hoxc8a-201

ID
ZDB-TSCRIPT-090929-4530
Name
hoxc8a-201
Previous Names
  • hoxc8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019656 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019656|OTTDARG00000016362|ZDB-GENE-990415-114 hoxc8a|OTTDARP00000016614 hoxc8a-001 LG_ BX005254.9 Danio rerio protein_coding KNOWN, 1186 bp
ACATCCACCGTGCACGCCATGATTTGAGGCTGCAAAAGGA
AAGGCTGGCGATAGGAAGAGAGAGAGAGAGAGACTAAGCG
AAAGGAGCTGAAGTGGGAGCTGCCTCAGATTGTCCGAAGG
GGCAGCATTTCTCCATCTAGTTCCGGTTGCTGTGTCTGCG
TTGCATGCCATTTGGAACTGCAACAATAGGTTGCCACCAT
TAGGAGAGGAGAATACATATATTTTTTCCAAACAGACTGA
CTCTTTTTAATGCTAGATAAACATGAGCTCTTATTTTGTT
AACCCTCTTTTTTCCAAGTACAAAGGCGGCGAAACATTAG
AGCCAACTTACTACGACTGCAGGTTTCCACAGAGCGTTGC
CCGAAGCCACACGCTTGTGTACGGACATGGAGCAGCTGCG
CCGGGGTTTCAACACCCGTCGCATCACGTACAGGACTTTT
TCCATCACGGAACCACAGGTATCTCCAACCCTGGGTATCA
ACAGAACCCCTGTGCATTGGCATGTCACGGAGACGCTACG
AAATTTTATGGATATGAAGCCCTTCCGAGGCAACCGCTTT
ATGGTACCCAGCAAGAGGCCACCTTAGCGCAATACCCAGA
CTGTAAATCGTCCAATAGCACTAACCCTGGAGAAGGACAA
GGCCACTTAAGTCAAAACTCCTCTCCGAGCCTCATGTTCC
CTTGGATGCGGCCTCACGCTCCTGGGAGACGCAATGGAAG
GCAGACATACAGCCGATACCAGACATTGGAGCTGGAGAAA
GAGTTCCTCTTCAACCCATACCTCACACGCAAGCGCCGTA
TTGAAGTGTCCCACGCGCTAAGCTTAACTGAACGACAGGT
GAAGATCTGGTTTCAGAATCGCCGAATGAAGTGGAAAAAA
GAAAATAACAAAGACAAATTTCCGGGGCAGAGAGGAGAGG
CTGAAGCAGAGGCCGAAGAAGAGGGCAATGAAGACGGTGA
AGCGGAGGAAGGAGAAGACAAGGAAACGGAAGAGAAAGAG
GAAAGCAAGGAGTGATTTTATGGTCTTTTTTATGGTTATA
TGGCAGATATTGAAGAGGTCTCACGAATGGGAAATGAAAG
AGAAGACGCGCCAATTTTATTACAAACAGTTGGGTCAAAA
AGTGAGAAAATCCCCCTCCATACAAATGTACATTGAAACC
TGCCCAAAGAAAAAAGGCTTCTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations