header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4522
Transcript Name: zgc:103438-204
Previous Name: zgc:103438-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019611 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019611|OTTDARG00000015707|ZDB-GENE-041010-131 zgc:103438|OTTDARP00000016585 DKEY-228A15.2-002 LG_ CR749752.5 Danio rerio protein_coding KNOWN, 789 bp
TAGATGTTGCGGTAGTTCTGACAGTGAAGGAAGCTTCAAT
TCTGATTACTGCAGAGGATGGCGCAGAAGATGACAACCAC
CAAACCAGATGATGACAGGGCAGTTCCTGATTTTGGAAAG
ATGTATCATGTCAAAGGTGTGATTTCATTGCCTTCCTATG
AGATAGAAGAACCTTTTGAAGCTTGGTACGACTTTGAGGA
GAACAGAAGTCGAATCGACTACTATAATGGTACAACGCGC
ACATTTCTGATTGGAAATGACTTGGATTATGGGGCCATTT
ACCAAATCAAACCAGTCCTTCCTCCCAGCGTTATTAAGTG
TTTCCAGCTTAAAGGTACCAAAGAGGAACCGATACGGCCA
CAGTCAGCAATGCCTGATGTACAGGGATTTGAGTTTGAGA
AGATGGAGGATTGCAAAGGGGTTCAGTGTGAGGTCTGGAA
AACCGTCACAGAGGCTGGCCATAAGAAGAACACATACCGT
CTGTGGGTCACACGTCCAGAGGGAAATTATGCTCCAGCCA
CACCACACCGCTTTGAGATGGAGGGCTTCAACACTCTTCT
AGATTCCCACAATGACAAATACAGCATTGAGTACAGTGAC
TTCTGCACACAATCTGAGCCTGATGTTTTCACTCCACCTG
CAGGATTTACCTGTGAAGAGTTTCCTGATCCTCCTGAGGA
GCGACAAATATTAGCCAATCCCATTCAAGACTATGTCAGC
ACCAACCCTGTTAGCCACGCCCACCGAATGTTTGGCCCCT
TTAAGGAGAAGTTTAATCGACAGTATAAA

zgc:103438 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA zgc:103438-203 (1) 1778
zgc:103438-204 789
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:103438-204 Contained in:
OTHER zgc:103438-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019611 (1)
  • Ensembl_Trans:ENSDART00000133695 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC134971 (1) 1609bp
    GenBank:DN765658 (1) 795bp
    GenBank:CK690653 (1) 677bp
    CITATIONS (2)