Transcript

ctdnep1a-201

ID
ZDB-TSCRIPT-090929-4459
Name
ctdnep1a-201
Previous Names
  • ctdnep1a-001
  • dullard-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019472 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019472|OTTDARG00000016236|ZDB-GENE-041114-177 ctdnep1a|OTTDARP00000016477 CH211-114C12.10-001 LG_ AL928875.4 Danio rerio protein_coding NOVEL, 2120 bp
CGGAAGTGACGAAACCAAAGTACCGATGGCGGCTCACAGT
TTGCTCCCGGACATGCACTAAAACGAATTTGATGGCGTCC
GATTGGACTTTTTGCACACTTGGCCGATTGACTGAGGTCT
TGAGATTAACATAGAAACCGTCGAGCACAAGGGTCGTCAA
TCCGAGGAGGGATCGTTTGTTGCAGAGCTCGTCAGATCCA
CAGCTAGCAGCCTTGCCAGTGAAATACAAGTACAGCTAGC
CTGTGATCGCAGAGGTTTGTTTGTGTGCGTGGCTGCACAC
TTTTGACACCTTTGACATTTTTGCAGTTTTGTGACACTGG
CTGGTCCAAGTGCAACAGAGCCTTTGCTTGTCTGTAGTTT
CCCCAGCGGCGTTTGCTTTACTTTACAAACAGAGAAGCGG
CGGGAAGTGGTTAGCCGACCCGATTAGCTATAGCCGCACA
CTTCGGCTCTTCTCTTCATCTCTGCGGATGGTGAGAGTGT
TTTCTATGATTGCGCCGATCATCGACTGTCAGCATGTTGA
AGACTCGTCAGTGTCTACTGGGGATTCGCACCTTCCTCGG
AGTGACGTCTAGAATATGGAGTTTCTTTTTATACATCCTC
AGGAAGCATCTACGAACGATAATCCAGTACCAAACAGTGC
GTTATGACATATTACCTCTCTCCCCCATTTCCAGAAACAG
ACTCAATGCGGTGAAGAGGAAGATCTTGGTGTTGGATCTG
GATGAGACTTTGATTCATTCTCACCATGATGGTGTCCTTA
GACCCACAGTAAGGCCGGGAACACCACCAGACTTTATCCT
CAAGGTGGTAATAGACAAACACCCAGTCAGGTTTTTTGTC
CATAAAAGGCCACATGTTGATTTCTTTTTAGAAGTGGTTA
GTCAGTGGTATGAGTTGGTAGTATTTACAGCTAGCATGGA
GATATATGGATCAGCCGTAGCAGATAAGCTGGATAACAAC
AGAGGCATCCTCAAAAGAAGATACTATAGACAGCACTGCA
CTTTGGATCTAGGGAGCTACATTAAAGATCTGTCTGTAGT
ACACAGTGACCTCTCCAGTATAGTTATTTTGGATAACTCA
CCAGGAGCTTATCGAAGTCACCCAGACAATGCAATACCTA
TAAAGTCTTGGTTCAGTGACCCAAGTGACACGGCACTTCT
TAACCTGCTCCCGATGTTGGACGCATTGAGGTTTACCTCA
GATGTTCGCTCCGTCCTCAGTCGAAATCTTCACCAGCACC
GGCTCTGGTGATCCTATCTGTCAGGACCAGTTTCTCTTCT
GGTCACCGTCTTGATTTTACATGGCTCTGCCCGCTAGGTG
TTAACCTCTCCTGCGCTGGAGTTTCAGCCTCTCGTCATCA
TTTGAGCTCCCATCAGTCATAAGGACTCCTCTGAGAAGAC
ATGGGAGGACAGAAAGGAGAATAAGAGAAGAAACTATTAC
AAATGAACTCAACGAATCGAGAGGCATTTTTCTTGTATTT
CTTTCCATAAAAAACGGAACCTCTGCCTTACGGTTGTTGG
ATTCAACGTGTGCATGTTGGAGTATTTCTGAATTGGGGAG
AATGTGTCTGATTGCAACTTTACCCTTCATTTATCAGGGT
AAATGAAGAATCATTTAATGGTTTATAACTACCAGTCAGT
TTCCACAAATCATTAGCACTTCCGCAGTGTCTTTTGTCTT
TTAAGTTACGTATGACCTTAGCACAAATGGTCGTTTCCAC
TCATTCTCTCTTAAAGCTTCTGTCCTTTTCTCTCTCTTTT
TTTTTTTTCTTTTTCAGTCGGCCATCTCAGGTATCTGGCC
TCTTCTCTGTGTCAAGAGCTGAGAGCAGTTAATACCGTTG
TACTAATAGTATGCTGTGGTAGAGATAACTGTAAGGTCAG
CAAGAGTGAAAACTACAGTCCATTATTACAGCTCATGGTA
TTAATTTTCTGTGTATTTTTAAATGGCTCATGTGGAGCCT
CTGGTTAAAGCTGAGAGGTTTTATCTTCTATTTCAAGGAC
AGATTTTTTAGATGCTCTTCGATGTGGATACATCAGCCGC
TGTGAAAGAGAGAGAGAGACACTGAGCAACAAGGACTCTG
CTATAACAGAAATAAAATGGAGCCTTTTGTCAACAACCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations