ZFIN ID: ZDB-TSCRIPT-090929-4446
Transcript Name: mrps31-202
Previous Name: mrps31-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019444 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019444|OTTDARG00000016212|ZDB-GENE-030131-3715 mrps31|OTTDARP00000016451 CH211-114C12.1-001 LG_none AL928875.4,BX119902.4 Danio rerio protein_coding NOVEL, 1599 bp
AGTTGTCAGCGCTGCACAGGGAAACGTGCATGGACGACAT
TGAGGTCTTGTAAGAGGGGCAAATATGTACAGAAGATTGT
TAATAAATATACATCAGGTTCGAAATGGATTAATTCATGC
ACAGAAGACACGAACACCCTCCGTAAAATGTAAAGAAAAT
GAGGGTTTTGCTCACACGTTTTGGACCACAGGTTCAACAA
GCCACAGGCCATTAGGAACCAGTAGCATCTGTTTTAGTGA
CAATAAAGAGAGCTCCACATCCCTGTCAGATGACAAAGAA
AAGAGACGAGAAGAGAATGAGGCTAAAGCTGAAGTTGGCA
CTGATGGCCAGAGGAACACAGAAATTAAAAAGGGCCCGGA
TATATCAAATACAGCTTTGACATCAGAACTAGAGACTGAA
GTAGAGTTGAAACCTAAGGAAATCAAGAAACCTGAAAAAG
AGAAAACTGGGAAGGAGAGTCTTCTGGAGCTGCTTGGGGC
AATGAAGGTGGATGTCACTACTGTGCGTAAAGTGAGACCC
CCAAGGTTTCCTCGAATCAGTGAAAAACCCAGCACAGACC
AAATGGAAAGCACACAGAGCATGTTTCAGGATGCCATGGC
TGAGGGTTCGAAACAGCGCGAGACCTTGAATCCAGCGCTG
GTTGCTGCAGCTTCTGCAGCTGCGTCCACGTTGCCAAACA
GCCAACAGGTGGAGTCAGAGCTCCTCCAGCAGCTGAGGAA
ACATGAAGCAGAACCGGACGCTCAGAGAGCCGACAGACAG
AACATAGGAGACATAATTGCTGATATGAAAGTTGGGAAAA
GGCAGATGGGCAGATCAAACAGCAGGCCCAGCAATCAGAT
CCGCTTTGATGATGACGGACAGGGCTATACAGAAGACAGA
AGCATTACCAGTGAACTGATGAATGGAATTCACAGAAGGA
AGAACTCCTTCACTGGCAAGAGGTTAAACATCTTCTCTCC
AGGTATGGAGCAAGAATCGTCAGAAATGGGCCCGACCCTT
TGGGATATTGATTTAGCGAATCAAATTGTTCAGTCGACAA
ATCAGATGCCTCGTAATGGCTTTGAGGAGATGATGCAGTG
GACCAAAGAGGGCAAACTCTGGCAATACCCAATCAACAAT
GAGGCTGGTCTGGATGAGGAGGCGAGCGTACCCTTCCATG
AGCACGTGTTCCTGGAGAAGCACCTGGAATCGTTTCCCCG
GCAGGGTCCAGTCAGGCACTTCATGGAGCTTGTAATCACA
GGCCTCTCAAAGAATCATCACCTCACAGTTCAACAGAAAC
AGGAGCATATCGCCTGGTTTAGAGACTACTTCCAGCAGAA
AGATGATGTAATGAAAGAGGCTCAAGCGTAACTTTACTGA
AGATCAAAACCAGAGAGGAATAAAGTCCGTTAAGATGCTT
ACTGCAGTAATGACTAATAGAACTAAGCAACAATTGCATC
CATAATCTGCTTAAGTCTCCATTACATATTAAATCTTTTT
CATTAAATTGTATGCTGCTCGTTATTCAGTTCACTGGTAT
GTTTTATGTGTTGCTTTAAAGCAACATAAAGAATTTTACA
AAATAATTGAGACAATTACTATTTTCCTTATTAACACCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrps31-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000019444 (1),  Ensembl_Trans:ENSDART00000147007 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW174066 (1) 682 nt
GenBank:BI878706 (1) 615 nt
GenBank:AI877718 (1) 590 nt
GenBank:AI497541 (1) 530 nt
GenBank:BM035422 (1) 508 nt
GenBank:CB360009 (1) 445 nt
CITATIONS (2)