Transcript

mrps31-202

ID
ZDB-TSCRIPT-090929-4446
Name
mrps31-202
Previous Names
  • mrps31-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019444 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019444|OTTDARG00000016212|ZDB-GENE-030131-3715 mrps31|OTTDARP00000016451 CH211-114C12.1-001 LG_none AL928875.4,BX119902.4 Danio rerio protein_coding NOVEL, 1599 bp
AGTTGTCAGCGCTGCACAGGGAAACGTGCATGGACGACAT
TGAGGTCTTGTAAGAGGGGCAAATATGTACAGAAGATTGT
TAATAAATATACATCAGGTTCGAAATGGATTAATTCATGC
ACAGAAGACACGAACACCCTCCGTAAAATGTAAAGAAAAT
GAGGGTTTTGCTCACACGTTTTGGACCACAGGTTCAACAA
GCCACAGGCCATTAGGAACCAGTAGCATCTGTTTTAGTGA
CAATAAAGAGAGCTCCACATCCCTGTCAGATGACAAAGAA
AAGAGACGAGAAGAGAATGAGGCTAAAGCTGAAGTTGGCA
CTGATGGCCAGAGGAACACAGAAATTAAAAAGGGCCCGGA
TATATCAAATACAGCTTTGACATCAGAACTAGAGACTGAA
GTAGAGTTGAAACCTAAGGAAATCAAGAAACCTGAAAAAG
AGAAAACTGGGAAGGAGAGTCTTCTGGAGCTGCTTGGGGC
AATGAAGGTGGATGTCACTACTGTGCGTAAAGTGAGACCC
CCAAGGTTTCCTCGAATCAGTGAAAAACCCAGCACAGACC
AAATGGAAAGCACACAGAGCATGTTTCAGGATGCCATGGC
TGAGGGTTCGAAACAGCGCGAGACCTTGAATCCAGCGCTG
GTTGCTGCAGCTTCTGCAGCTGCGTCCACGTTGCCAAACA
GCCAACAGGTGGAGTCAGAGCTCCTCCAGCAGCTGAGGAA
ACATGAAGCAGAACCGGACGCTCAGAGAGCCGACAGACAG
AACATAGGAGACATAATTGCTGATATGAAAGTTGGGAAAA
GGCAGATGGGCAGATCAAACAGCAGGCCCAGCAATCAGAT
CCGCTTTGATGATGACGGACAGGGCTATACAGAAGACAGA
AGCATTACCAGTGAACTGATGAATGGAATTCACAGAAGGA
AGAACTCCTTCACTGGCAAGAGGTTAAACATCTTCTCTCC
AGGTATGGAGCAAGAATCGTCAGAAATGGGCCCGACCCTT
TGGGATATTGATTTAGCGAATCAAATTGTTCAGTCGACAA
ATCAGATGCCTCGTAATGGCTTTGAGGAGATGATGCAGTG
GACCAAAGAGGGCAAACTCTGGCAATACCCAATCAACAAT
GAGGCTGGTCTGGATGAGGAGGCGAGCGTACCCTTCCATG
AGCACGTGTTCCTGGAGAAGCACCTGGAATCGTTTCCCCG
GCAGGGTCCAGTCAGGCACTTCATGGAGCTTGTAATCACA
GGCCTCTCAAAGAATCATCACCTCACAGTTCAACAGAAAC
AGGAGCATATCGCCTGGTTTAGAGACTACTTCCAGCAGAA
AGATGATGTAATGAAAGAGGCTCAAGCGTAACTTTACTGA
AGATCAAAACCAGAGAGGAATAAAGTCCGTTAAGATGCTT
ACTGCAGTAATGACTAATAGAACTAAGCAACAATTGCATC
CATAATCTGCTTAAGTCTCCATTACATATTAAATCTTTTT
CATTAAATTGTATGCTGCTCGTTATTCAGTTCACTGGTAT
GTTTTATGTGTTGCTTTAAAGCAACATAAAGAATTTTACA
AAATAATTGAGACAATTACTATTTTCCTTATTAACACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations