Transcript

senp3a-201

ID
ZDB-TSCRIPT-090929-4437
Name
senp3a-201
Previous Names
  • senp3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019435 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019435|OTTDARG00000016204|ZDB-GENE-030131-2303 senp3a|OTTDARP00000016442 CH211-137I24.6-001 LG_ BX119902.4 Danio rerio protein_coding NOVEL, 2387 bp
GAGTGTTTTCGCTGTAAAGAAGCGCCAGCTCTCATTGAAT
GAGCCAAGATTTAAATTAGCCTTTATTTTCTCTTTCATTT
TCTGTCCTCGAAAAGCTTAGTTATCCGCTTTTTGCCTTGG
CGGACAACGCCTGAGCTTTTGGCGAGAGCATACGGTTAAA
CGTGAAGGAGGCAGGCTGGCGCAGGTTGTAGGGTGCTCCT
GGATCATGAGAGACAGTGGCAGCAGCCTGGCTCAAACACA
CTGGTCTAATGAGCTGACGCTGACTGCTGGGCAGGAGGGC
GCCGGGGGTGGGGGTGCCATTGGAGGGGGTCATTTAATGA
ACCCAGCCATGGCTCAACATGCCCCGAGCCCAGCCCATTT
TAAACTGGGGCGCAGAGAGGAAGACGTCAGAATGTGGGGT
GCAGACTACACAGTCCCCGAGGTGGAGGACGAGGAAGAGG
AGGAGGAGGAAGAAGAAGAGGATGATGTGGAGATGGAGAG
TGGAGAAGATCTGGAGGATCAAGGCATTTTTCATCTTCAA
GATCAAGGGGATGACAAGGATTGGGGAACACCGGAGCATT
CGCAGGTGGCAGAAATGGATGTCAGGGTTACTGATGACTT
TACCCACTGCATGGCGCAGAGGAGACCCAGACTGCTCAAA
GTGAGAAGGCTAGCTCGGTTGCCAAATCGGGGCCGAAGGT
ACCTGAGCATTCGTTTTCGTCTGGCCCAGCACTGGAGAAC
TTGGCGCCAACGAGCCAAATGGGCGGGAACTATGGGATAC
AGGAGGGTTCGCAGATGTCACAGACGTCGTTACTTTGGCA
GTCAACATTTCCAGAGGCCGCCGGGACGTTCGTTGTTAAA
TGGGGACCCAGAAGGCCGTTTGCAGGGAACAGAGATATCT
GACTCCTGTAGCACAAATGGGGCCCTAAAGGGTAGAGATG
GTCTCCATGGAGCAGTCTTGGGGGAGCGGGAAGGACGGGC
CTCCCCTACTAATGTCCAATCTCAACGGGAAAAGGCCTCC
TTACAGAATCAACTCAGCAGTGAACACATTTCTTGTGTAC
AAGGTATTCTGGATGAATTTCTCCAACAGTATGGCAGTTT
GATTCCCATTCATGTGGATGAGGTGGTGGAGAAGCTTCAA
GAGATTTTTACTGAGAGCTTCTCAAGTCCTCACAGGAAGA
TAATGGTGCAACATTTAATGCAGTCCTACCAGCGGATGTC
TGGAAGTGCAATGATGCGGGGGTTTCGTGTAAATTACAAG
CGTCATGTACTTGTCATGGATGATCTGACAACACTTTATG
GCCAGAATTGGCTCAATGATCAGGTCATGAACATGTATGG
GGATTTGGTCATGGATGCTGCCCCTGAAAAAGTCCACTTT
TTTAACAGCTTCTTTTATGACAAACTTCGGACAAAAGGAT
ACGAAGGTGTCAAACGGTGGACAAAAAATGTTGATATTTT
CCAGAAGAAGTTCTTATTGATCCCTATTCACCTGGAAGTG
CACTGGTCATTAGTGTGTGTGAATGTTCCTCAGCGTAGCG
TCACATACTTCGATTCCCAGAGGACCCTAAACCGCCGATG
TCCCAAACATATTGCCAAATACCTGCAAGCAGAGGCAATC
AAGAGAGAACAGAAGGACTTTTACACAGGGTGGAAAGGCT
TTTTTAAAATGAATGTGGCAAGGCAGAACAATGACAGTGA
TTGTGGAGCTTTTGTCCTTCAGTACTGTAAGTGCCTGGCC
CTGGAACAGCCTTTCAGCTTCGGCCAACAGGATATGCCCA
AGCTACGGAGACAAATGTACAAAGAACTGTGTCACTGTAA
ACTGTCTCTGTGAGACCGTAGAAGAGCAAGAGAGATCTTT
GACATCTTTCACGTCTAAATAAGCTCCAAGTCCAGACAGC
GTGGGACGTGCAAACGTTTTTATCCCTCTTTTCTTTCAAT
GACTTTGTATTTTGACTTGGTGAATGCCATCCTCTGTTCA
GCCCAGTTGTTTGTTTGCTCAGATTTAAAAAAAAAGAAAA
GAAAGTAAGCTGGTTTCTAGAAATGAGAGGGAGATCAACC
TCAGTGAACTGTTCATTAGGTGCCGCCATTTTGTTGGCAA
TTACTTTTTTCATGTTCTTGATGTCAGTAACTTGTATGCT
AAAACAGTAATTCCATTGAGTGGTGAAAGGAGACTTGCAG
ACATTTTAAAAATGTATTGCGCTATACACATACTGAGTCA
ATATGGACCACGACACTATATTATTTTTGTTTGTTCAATA
TTGTTTGTCTGTCGTTATGTACCTGTGCGATTTAAGATGC
AAAAGTATGGAGAAAAAAAAAGTGCAGCTGTAAATTAAAC
CGTTTTATATCTTTTGAGATGCATACGTTGTTGTAAGCTG
TACTAATAAAAAACATGAAGACAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations