Transcript

limk2-201

ID
ZDB-TSCRIPT-090929-4405
Name
limk2-201
Previous Names
  • limk2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019351 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019351|OTTDARG00000016139|ZDB-GENE-040718-398 limk2|OTTDARP00000016368 CH211-225B11.2-001 LG_ BX927203.12 Danio rerio protein_coding KNOWN, 3536 bp
CTTGCCTGGAAAATTGACGAAACCCTGTTTCTCCGTTAAA
TCAGAGCTGGATTTAGGCTGCGGTTCTTACACATGGATCA
GAAACGGAGCATCGTTGATGTGCACCGTGTGAACGTCAGG
CTTTTCAGGACCAGCATGTGAGCTTGAACAAATATAATTA
AATCAGATCGGGGAGGACATGGATGAACGAGAAGATGTGA
CGGAGCGCGCGTGCACGGGCTGTGGCGGGAGGATTCAGGA
CGCTTTTCATGTGAAGGTTCTTCAAGACGCCTGGCACAAC
TCATGCTTTCAGTGTTCTGTCTGCTTTGATCTCCTGACCA
ACTGGTACTTTGAGAAAGAGGGGAGGCTGTTCTGTCACAA
ACACTACTGCGAGAAGTTTGGGGAATTGTGCCATGGCTGC
TCACTGCTTATGACGGGACCTGCCATGGTGGCAGGAGACT
ATAAATACCACCCCGAATGCTTTGTGTGTTTGAGCTGCAG
GGTGGTGATTGAAGATAGAGACACCTATGCCTTAGTGGAA
CGTACAAAACTTTACTGTGGTAAATGCTACAAGCAGGTGG
TCCTGACACCAGTGTTGGAGAAGCGGGGTTTGGCTGACTC
TCCATCAGACCTGCTCCCTCACACAGTGACTCTGGTGTCC
ATGCCTGCTGCCACCAATGGCAAAAGAGGCTTCTCTGTCA
GCGTGATTAGAGACTGCACCAGTGCCATTGCCAGCGTCCA
GGTTAAAGAGGTCAGAGGGATGCATATTAGTCCTGAGGTT
CGGAATGCCATCCATGTTGGGGACCGAATCCTGGAGATCA
ATGGACTCCCAGTGACATCCCTGATAGAGGAAGAGGTGGA
GGACCTCATCCATCGGACCAGTCAGACACTGCAGCTGCTA
ATGGAATATGATCCAGTCAGACAGCGTCTGGACCGACTCC
GTCTGGGCTCTCCCCGCAATAAGCTGGGTGTCCCTGTAGT
GTCTCGTATGAGACTCTCCTCACCAGTAGATGCTGAGATT
GAACGGAGTGACACAGTGGACAATGGGACGTTAAAGAGGA
GGTCCCTCAGACGTAGCAACAGCATCTGCAAGTCTCCAGT
CTCTTCATCTCCCAAGGACCATCTAGTTCTGACTCGAGAT
ATCGGCCGCTCTGAATCTCTCCGCTCTCCTTCCAGCTGCT
CTCACCGCATCTTCCGTCCCTGTGACCTCATCCATGGAGA
AATCCTTGGCAAAGGCTTCTTTGGACAGGCCATTAAGGTG
ACCCATAAAGCCACTGGTGAGGTGATGGTCATGAAAGAGC
TGATCCGCTGTGATGAAGAGACACAGAAAACGTTCCTAAA
GGAGGTAAAAGTGATGAGAAGTCTTGATCACACACACGTT
TTGAAGTTCATCGGGGTTTTGTACAAGGACAAGCGTCTTA
ATCTGATAACAGAGTTCATTGAGGGAGGCACTCTTAAGGA
TTTCATCCGAGACACGGACTCATTCCCATGGGAACAGAGA
GTTAGTTTTGCAAAGAGCATTGCATCTGGAATGGCATATC
TGCATTCAATGAGCATCATACATCGAGATCTCAACTCTCA
CAATTGCCTGGTCAAACTGGACAACACCGTCGTGGTGGCA
GATTTTGGTTTATCTCGGTTAATCATGGAGGACAAAGTAA
AGCAGCCTCCCCCGGACAAACCAACTAATAAGAAAAGGCT
GTTTAGACGCATTGATCGCAAGAAACGCTACACGGTGGTG
GGGAACCCTTACTGGATGGCCCCAGAGATGCTCAATGGTA
AACGCTACGACGAGAAGGTGGATATTTTCTCCTTTGGCAT
TGTACTCTGTGAGATTATTGGTCAGGTTTATGCAGATCCC
GAGTGTCTTCCAAGAACACTGGATTTTGGGCTGAATGTGC
GAACGTTCATCGAGAAGTTTCTTCCTGAGCACTGTCCTCC
TGCTTTCTTTGCATTGGCTGTGGCCTGTTGTGACCTCACT
CCTGACAACCGGCCTGCTTTTCAAAAGCTGGAGGACTGTT
TCGAGGCATTAACTTTCAATCAGGAGTTGAACATCCCTCT
ACCTGCTGAACTGGACGAACTTCAGCAGAAGTTTTTAAGG
ACTTATGGACCCAGTGAAATCGCCTCTGAAAACCAGGAAA
ACAACAGGAACTAATCCAATGGCAGCGCAGGCCGAGCTGG
AAACTTTTTTGTTTTGTTGATAAGTTTACAGAACTGGAGA
GCATTTACCTTGTATTGGCATACTGGGAACATGCTGATGC
TGACGTTCCTTTGGAGATCTCTCATGTCATGTAGAACTTT
GAGGGCATTCTTGAACTGAAGGTTCTGTTGAGGGAACGGG
TACATTTCAGTGAGCTTCAGCTTCTTTCTGATGGAGTTTT
TTTTTCCCTTTTTCGGTCTACTTTTGTAACTAGCAGGTCT
AACTAATTGATGATTTAACCAGGTAACTGCAACCATTAAG
AGTGCCTGTCATTAGATGAGTTCTGATCGATTGTTCTGAT
GAAGTAATATCAGAAATAGTGTGGTGTCATCTACTTAAAC
AATGATGTTTGACTATATAATTAAAAAAAAAGTTTGTTTG
GTGAATCTAATGAAACTAGTCCAAAATATGTCACATTTCA
CCCCAGAATGCAAATTCATTATCTGTTAAAATTTAAAAGT
CTAAACGCACAATAATAATTATTGAGGAAATGTACTTAAT
TGTCACAAATAATACAGTGAAAATAAAGGCTGAAATGTGA
CGGTCATGTTTGAACCTCTTCTCTTCATAAGTTTTTGTTG
ACTATTTTTTTTATTTTTTAATTTTTAAATGACCTAAACT
GTAGGAATGTAAATGACTTGTTGTTCCACACTGCCCTCTG
CAGGTGCCTTTGTGCACTCAACCCTTGTTGGTTTCAGTAC
CACAAGCACTTGAGGTCCTGTTACTCTTTAATACGAAGAC
CGTGACAAAACTGTTACGAAATGAAGTAACAAGTTTCTGA
GTTTTGATTTGGTTTCATATGTGTGGTGGTTTCTCAGAAA
TGCTTTGTGTTTTTCATATTGTAGCTCATTTTTGGTACAT
CAGCTATATGAGAACTGGAGTTGTCTATTCCTCTGTCAAG
GACTCACCTTGTAAATATACCTTGGCAGGGAGTAAAAACA
AATATTCTGTATCTAAACTTCTCTGGAGTTGAAGTGAAAT
GATAAGTGAGATCGTAATGCTGGATCCTGACTGGCCGTTT
CAATGATTTCTCATAAGTGAAACAGGCTGTAATCAAAATA
AATCTGAACAAGTGACGTTTTGTGAGGATGTTTGGAGAAA
AAAAAACGAATGTCATCCTCACTTTGATCACAGGTGTTTA
ATTTAAAACTGGATATATTTTTCATGTTTGTAAAGATTTG
TTGCCAAATGTGGATGTGTAGTTTGCATATGTTTGTAGAA
TGTGAAAAGCTGTATAAAGATGTTTTTTCTTAGTCTTATC
TGTCAATGGTACTGACATGTATAAAAATATAACCACTACT
TGTATGCCACAGGATTTACACGTATGTTTCATGAATAAAG
ACGAGTTAGTAATGGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations