ZFIN ID: ZDB-TSCRIPT-090929-4370
Transcript Name: dao.1-202
Previous Name: dao.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019275 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019275|OTTDARG00000016077|ZDB-GENE-050913-127 dao.1|OTTDARP00000016297 DKEY-72N1.5-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1682 bp
GGTAAGGACGTGTTTAGACCAACGCTGACAAGAAGAAACT
TTGCATTTCTGCAGTCATGAGAGTGTGCATCATTGGCGCG
GGGGTCATCGGTCTCTCCACTGCTCAGAGCATCTACCAGC
ACTTCCACAGCAGAGTCTCTCCTCTCACCATAGAGGTTTA
TGCTGATATCTTCACCCCTCTGACCACCAGCGATGGGGCA
GCTGGATTCTGGCAGCCCTATCTCTACGACAAGGGCAACG
TCAAAGAAACTCAATGGAACAAAGAGACGTTTAACTATCT
ACTGAGTTTCCTCAACTCTCCAGATTCAATCAAAATGGGA
ATCTTCCTTGAGTCTGGCTACAATCTGTGTTTTGAACCAA
TGCCGGAGCCCTCGTTTAAACAAGCTGTTTTGGGTTTTCG
TCAGCTTTCTAAACGTGAATTAGAGATGTTCCCGGGTTTC
AGTTTTGGCTGGTTTAACACTGCTCTCGTAATTGAAGGAA
AGTCGTATTTACCCTGGCTCATGGATTGGTTAAATCAAAG
AGGGGTCAAATTTTTTCAGAGGAAGATTGATTCATTTAAA
GAGTTGTCAGACAGTGGTGCTGATATGATCATCAACTGCT
CTGGTGTCCGCTCAGGAGATCTGCAGCCTGATCCTGAGCT
CCAGCCAGCCAGAGGACAGATCATTAAGGTAGACGCCCCC
TGGTTAAAGCACTGGGTCATCACGCATGATTCCAAATTAG
GAACCTATAATACACCGTACATCATTCCTGGGAGTCGTTT
GGTCACTGTTGGAGGAGTTTTCCAAGTGGGAAACTGGAAT
CGGATGAACAGTTCTGTTGAGCATAAACAAATCTGGGAAG
GCGCCTGCAAACTTGAGCCCAGTCTACAGCATGCGCGGAT
AGTAGAAGACTGGACTGGTCTCAGACCTGCACGCAGTAAA
GTCAGACTAGAGAGAGAATCCATACGATGTGGAGGACACT
CATTTGAGGTCATCCATAACTATGGACATGGAGGTTTTGG
GCTGACCATCCATCGTGGGTGTGCTGAGGAAGCTGCTCGG
CTATTTGGACAGTTCCTGGAGCAGAAAGGATTGCTAACAT
CACAGGCTAAATCACGTCTCTGAAAGATCTGAGCCCCTTT
GTACAGTGTTATCATTAAACAGACATCAGCAATATTTTTC
CTTAATCCCATGTACATCTGATTTCAAAAAGCTACCATAT
AACTATTACTATGTAATGTTTGTGATATGCGTCATGAGTT
GTCCAATGTTTCATTATTTTTTTGACAGCATTATCATTGT
GTATGGTGGTGCGTGCCGTTAATGGCAAAAAACAAATCAC
AGTAGCTGTCTGGCAATGCCAGTGGTGGACTATTCTTCTC
CAAGGAAAGTTAAACGAGCAGCTAAATTACAATACTTTGC
TCTAACTTGTATTTTTCTATGATTTAGTTTTTTTTATTTT
ACACAAACTTGTCTTAACGAATGTCTTGATGAACTGGGAC
ACAGCAGCTCTTCTGGCTTTCCTCTTCTTCTTTTTGTTAC
GTTTCTGGTGCCCTGATTTATGTTCTCATTTAATTTTATC
AGTCGGTCAATCCTTTGATCAAGTTTATCTACAAATTCAA
CACTGGTCTTATTCACAAGAGGGTGGGACTTTTACAATTT
TACCTCTCACTGACTAAATAAATTTTATTTAATCAAACTG
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dao.1-202 Contained in:
[BAC] DKEY-72N1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000019275 (1),  Ensembl_Trans:ENSDART00000139675 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD758666 (1) 840 nt
GenBank:CD284711 (1) 750 nt
GenBank:CF543836 (1) 628 nt
GenBank:AI958489 (1) 573 nt
GenBank:AI958559 (1) 481 nt
GenBank:AI477796 (1) 452 nt
GenBank:AI584764 (1) 437 nt
CITATIONS (2)