Transcript

usp30-201

ID
ZDB-TSCRIPT-090929-4369
Name
usp30-201
Previous Names
  • usp30-001
  • si:dkey-72n1.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000019274 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019274|OTTDARG00000016076|ZDB-GENE-060526-335 usp30|OTTDARP00000016296 DKEY-72N1.2-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1811 bp
ATGCCTTGGTGCAAGCAAGGAACTACAGACAAGCTTGTAC
GAGAGTTTTTACGCACTGGGGCCGCTGCAAGGAACAAGAT
GATGAAGAACTGGGGCGTGATTGGTGGAATAGCTGCTGCC
ATGGCTGCTGGAGTCTATGTACTATGGGGGCCAATTTCAG
ACAGGAGGAAGAAGAGAAAAGGTATGGTTCCTGGTCTGCT
TAATCTGGGGAACACGTGTTTTATGAACTCACTTCTCCAG
GGTCTGGCAGCGTGTCCTTCCTTCATCCGATGGCTTGAAG
ACTTCACAAGTCAAAACAGCGCTGATCGAGAGAGAACGGA
AAGAGAAACTCAGCTGTCCAGATCTCTGATGCAGTTACTT
AAAGCCCTGTCGAGTCATGATCCAGGAGAAGATGATGTTT
TAGATGCCGGAGGCCTTTTGGAAGCGCTCAGACTTTACAG
ATGGCACATCAGCTCATTCGAGGAACAGGATGCTCATGAG
CTCTTTCATGTTCTCACATCATCATTAGAGGAAGAACAGG
AACGCCAACCCAGAGTCGCTCACCTCTTCGACATGCAAAC
ACTGGAGAAATCTGTGGAGTCCAAAGAGAAAAACATTAGT
TGTCGAAGTGGAGGCCCACTGCATCCTATTCCTAGTTTAT
GGAGAACTAGGCATCCTTTTCATGGACGGTTAACAAGTTA
TATGGCTTGCAAGCGCTGCGAACAACAGAGTCCTGTGCAT
TATGACTCTTTCGACAGCTTGTCTCTTTCGATCCCTTCAA
TACAGTGGGGTCGACCTGTTACTTTGGACCAGTGTTTACA
GCATTTCATCTCCTCTGAAACCATCAAAGAAGTGGAATGT
GAAAACTGCACCAAGCAGCAGGCTGGAGAGCTAGTAAATG
GAGAAGTGCTTGAGAGTCAGAGGACGACATTTGTCAAGCA
GCTGAAACTTGGAAAGAGACTGACGTGGTCTAAAGAGGGC
AGTCCCATAAAGAGACAGGAGCATGTTCAGTTTACAGAAT
ATTTATCTCTGGATCGATACAAACACTGTAGTGCTGCTCA
GAGCCAGCAGAAGACCAGCAGAACAAATAAGGCCAAAGCT
TCCGCAGACCCAAAGGACAAAGCCATTGCTAATGGTGTTG
ATTCAGAGCACTGTAATAACAACAAGCCACAGTCCAATGG
AACTTTCCCCTCTGTCTTTCTGCACTCACCTGGTCTAAGC
TCACAACTTAACCTCACGTACGACTACAGCACCTCGGAGT
ACCTCTTCCGCTTAACGGCGGTGCTGGTTCATCATGGAGA
CATGCATTCGGGTCATTTTATCACTTACCGCCGCTGTCCT
GCCGCTCCGCGTGGGACTTCTCCATTCAGCTCGCAGTGGC
TGTGGGTGTCTGATGACTCTGTGAGGAAGGCCAGTCTTCA
GGAGGTGCTCTCCTCCAGTGCATATCTGCTCTTTTATGAG
CGAATGCAGAGGCCTGGTCTGAGGGTAGAAGAGTAGCATT
TCAGCGGACTTAGTTAAACGCCAGAGTGTTATTAACTCTC
CATTCCATGCTATATGCTACTTATGGCCAAGTGGATTTGT
GCATCCCAGTGCATGAAGTTTGGCATGCGTATTGTTTTTT
TTCTTTCTTCATGAGAAAGAGAGAGAGAAAATTTGGGTTT
TGCATATCACAGATAGCACCTTAAAGAGATAGCTTACCCA
CTTACTTACCATTTACTTGATTCTTTCTGTCAAACACTAA
AGAAGATACTTTGAAGAATGTTGAAAACTGGTAGCCATTA
CCTTTTGTAGTATTTTAAATGTCAACGGCTACCGAATATC
TTTTTATTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations