Transcript

dao.3-201

ID
ZDB-TSCRIPT-090929-4368
Name
dao.3-201
Previous Names
  • dao.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019273 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019273|OTTDARG00000016075|ZDB-GENE-040426-1894 dao.3|OTTDARP00000016295 DKEY-72N1.4-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1384 bp
AAGCAGGACTGTTTGCACTAGTTTTCTACTAGACAGCTTA
ATTAAGTCATGAAGGTGTGCATCATTGGCGCAGGGGTCAT
CGGTCTCTCCACTGCTCAGAGCATCTACCAGCACTTCCAC
AGCAGAGTCTCTCCTCTCACCATAGAGGTTTATGCTGATT
TCTTCACTCCTCTGACCACCAGCGATGGGGCAGCTGGACT
CTGGCAGCCCTATCTCTACGACAAGGGAATTGTCAAAGAA
ACTCAATGGAACAAAGAGACCTTTGACTATCTACTGAGTT
TCATCAACTCTCCAGATTCAATCAAAATGGGTATCTTCCT
TCAGTCTGGCTACAATCTGTGCGCTGAAACTGCAGCAGAC
CCCTCATTTAAAGACACAGTGCTGGGTTTTCGCCAACTGA
CCAGTCGTGAATTAGAGATGTTTCCGGGCTACAGCTTTGG
CTGGTTCAACACTTCTATCATGATTGAAGGAAAAACATAT
CTGCCCTGGCTGATGGACTGGTTAAAAGAAAGAAATGTCA
AGTTTTATCAAAGAAAGATTGATTCATTTAAAGAGTTGTC
AGCCTGTGGTGCTGATGTGATAATCAACTGCTCGGGTGTT
CGCTCAGGAGAGCTGCAGCCTGATCCTGAGCTCCAGCCAG
CCAGAGGACAGATCATTAAGGTAGACGCTCCCTGGATAAA
ACACTGGATCTCCACACATAATTTCTCGTCTAGGGGTAAT
TCAGCTTACATCATACCTGGGAGTCGTTTGGTCACTGTTG
GTGGAGTTTTCCAAGTGGGAAACTGGAATCGGCTGAACAG
TTCTGTTGACCATAAACAAATCTGGGAAGCCGCCTGCAAA
CTTGAGCCCAGTCTACAGCATGCGCGGATAGTAGAAGACT
GGACTGGTCTCAGACCTGCACGCAGTAAAGTCAGACTAGA
GAGAGAATCCATACGATGTGGAGGACACTCATTTGAGGTC
ATCCATAACTATGGACATGGAGGTTTTGGGCTGACCATCC
ATCGTGGATGTGCTGAGGAAGCTGCTCGGCTCTTTGGACA
GTTCCTGGAGCAGAAAGGCTTGCTTGTTCAATCTAAATCA
CAAGCAGCACAAGCTAAATCACGTCTCTGAAAAAATGTGA
GCCTCTTTGAACAGTGTTATGATTAATCTCGTCAGACATC
AGCAATATTTTTCCTTAATCTCATAACCGCTGTCAGACTG
ATTCCATAAGATAATGAATACACTGAGTGCAAAAATGTGT
ACCAGACTACTGGGATCTGCTGCAGCCTAATGTCACTGTT
TAAATGATCTATTTTATCACTCATTAATTTTTTAAAAACA
AATTGCAGAACTGAATTGTCAGCAATTTGCTCTTTTGATA
TACAATAAAGAATTAAATAAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations