Transcript

svopa-202

ID
ZDB-TSCRIPT-090929-4367
Name
svopa-202
Previous Names
  • svop-001
  • svopa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000019272 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019272|OTTDARG00000016074|ZDB-GENE-060526-336 svopa|OTTDARP00000016294 DKEY-72N1.3-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1615 bp
AGTGGTGAAATTTCGGCGGACAGGTGAAAGCACTCGCTCT
GAGGATGAGTGCTGTGGAAGGGAAGAGGTTTTGCAGGTGG
AGGGAGGACGAACGGATATGGAGTCTGTTTCTCTGGCCGA
TGGTGCTCCGGTGCCTCGGGAATTTGCCAACCCCACTGAT
GATACCTTCATGGTTGAGGATGCAGTGGAGGCCATTGGCT
TTGGGACATTTCAATGGAAACTGTCCATCCTGACTGGACT
TTCATGGATGGCCGACGCCATGGAGATGATGATTCTCAGT
ATATTGGCCCCTCAGCTGCACTGTGAGTGGGCACTGCCCA
GCTGGGAGGTGGCACTGCTAACTTCGGTAGTATTTATCGG
AATGATGATCAGCTCCTCATTATGGGGGAACATATCTGAT
AAATATGGGAGAAAAACAGGTCTGAAGATGAGTGTGTTAT
GGACCCTGTTCTATGGCATCCTCAGTGCATTTGCACCAAT
ATATGGATGGATCCTGTTCCTCCGAGCTCTGGTGGGCTTC
GGGATTGGAGGGGCTCCACAATCAGTAACATTGTATGCAG
AGTTTCTGCCCATGCGGTCCAGAGCCACTTGCATTCTGCT
GATAGAGATATTCTGGGCTTTGGGTACAGTATTTGAAGTG
CTGCTGGCTATTTTGGTGATGCCAACTTTGGGCTGGCGCT
GGCTGCTGGCCCTCTCCACCATTCCACTTTTCATTTTCGC
TTTTCTTTGCTTTTGGCTGCCGGAGAGCGCACGCTATGAC
GTGCTGACAGGGAATCAGGAGAAGGCACTGAACACACTCA
AACGCATCGCTGCAGAGAATAACGTCCCCATGCCACTGGG
AAAACTCATAGTGGCCAGACAGGAGGACAGAGGGAAAATT
CAGGATCTTTTCTCTCCACACTTCCGCTGGACCACAGTTC
TGCTCTGGTTCATATGGTTCTCTAATGCATTCTCATATTA
TGGAGTAGTTTTGCTGACCACTGAGCTTTTCCAGGAGGGG
GGTGTCTGTGGTGGGGCGAAGGGCAGTAAAATGGAGCCAG
GTTGCAGTCTGGAGTGCAAATATCTCAACTCGGATGATTA
CAAGGATCTTCTGTGGACCACACTTTCTGAATTTCCAGGC
CTGCTGGTGACCCTGTGGGCAATTGATCGATTAGGAAGGA
GGAAGACTATGGCACTGTGTTTCTTCGTCTTCTCCCTGTG
CATTGTGCCACTCTACAGCTGTGTGGGAAGGACATCTTTG
ACAGTATTCATATTCATTGCGAGGGCCTTCATCGCTGGAG
GTTTCCAGGCTGCATATGTGTACACGCCGGAGGTTTATCC
CACAGCTACGAGGGCGCTGGGTTTGGGCACCAGCAGTGGA
ATGGCTCGAGTTGGGGCACTCATCACACCATTTGTGGCAC
AGGTGATGCTGGAGTCATCGGTGTATCTGACACTGTCCGT
GTACTGCTGCTGCTGTCTGCTGGCTGCTATCGCCTCCTGT
GCGCTGCCCATAGAGACCACAGGACGAGGCCTGCAGGAGT
CCAGCCACAGAGAGTGGGGTCAGGAGATGATGGGACGCGC
CTCAGACCACAGTCCCGGAGGAATCCCACATTCCAGCTCC
GGATCGCAGGACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations