Transcript

fdx1b-201

ID
ZDB-TSCRIPT-090929-4309
Name
fdx1b-201
Previous Names
  • fdx1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000019119 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019119|OTTDARG00000015953|ZDB-GENE-060526-382 fdx1b|OTTDARP00000016152 RP71-5C20.1-001 LG_ BX465863.11 Danio rerio protein_coding NOVEL, 973 bp
ACAAGAATATTCAGTGAACAGGAACGTTTTATGCCCGGCA
TTACAAAAATAACCTAACATTAGCGTACTCACTGGCATAA
CTAAGCATATGCCTCACACAGACACTCAGCAAATTCGTCT
TCACCAAACAGCAGAGGGCGATAGTTTAATGGTTGGCCTT
CTCCTTGGAGCTTGCTGCTTTGTCCTTAAAGCAAATGACA
TCCCAAAATTGCATGCAGATTCTCTTCATTCAAAGGCACG
CTTGCACTAACACTTGCACAGCGGGACAGCATGGCATATC
GTATGTGTGTGCGAGTGTTGCTCCGTTCCAGTTCACTTCT
CGCGTGCCACCCAGGATCCGTAAGGAGCCATGCAGAATTT
CATCACACAGTTCCCAGTCTCTGTAGTCAATCCCAGCTGA
ACGGTTCTTCAAGCTCTAAAGTGCTGGTGCACTTTGTAAA
TCAGTCGGGGGTGAAGAGCAGCGTATTTGTCACAGAGGGA
GAGACTCTGCTAGATGTTGTCATCAAGAAGAATCTTGACT
TCAGTGGCTTTGGAGCATGCGAGGGCACTCTGGCCTGTTC
CACCTGTCACTTGATATTTGAGGAGAATGTGTTTGACAAA
CTGGAGCCAATGGTGGATGAAGAGATTGACATGCTGGATT
TGGCTTACGGAATCACCAAGACATCTCGATTGGGTTGTCA
GGTGACTGTGGAGCGCTGGATGGACGGAATGACTGTTCGC
GTGCCACAAGATATCAAAGATCAACGAGGAAAACAAGAGG
CTGTGAGCAGCAAATGATACACAAGTGCTTATACTTCAGA
CTTAAAATAATATATATTGTATATAATAACTATATACAGC
ATAACAAAAACAGTACTTTTACTTAGGATTAAACAATGGA
CAAATTTGTTTTCATCTTGTTCTATTCTGATTACATATGA
GTATGGTGCAATATAATTTCACAAAGCAATAAAATGGATG
TGACCTACCAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations