Transcript

rpl36a-201

ID
ZDB-TSCRIPT-090929-4308
Name
rpl36a-201
Previous Names
  • rpl36a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019118 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019118|OTTDARG00000015952|ZDB-GENE-020423-1 rpl36a|OTTDARP00000016151 rpl36a-001 LG_ BX470076.3 Danio rerio protein_coding KNOWN, 951 bp
CGGAGCGGACAGTGTGTTTGGTATGTCGACCGTTAGGTGG
TAGCATCATCACGCAGCAGCAGCAGCAGCAAACAGCGCGA
GAGTCTCTTGCGCGACCCGGTACTAATGCTCTGAGTGACG
TCTATACTTCCTCTTTGCTCCTGCGCCGCGAGGGCAACCA
TGGTAAACGTACCGAAGACCCGCAGGACGTACTGCAAAAA
ATGCAAGAAACACCAGCCGCATAAAGTGACCCAGTACAAG
AAGGGTAAAGACTCTCTGTACGCCCAGGGAAAGAGGCGTT
ACGACAGAAAGCAGAGTGGTTATGGAGGACAGACCAAGCC
TATTTTCCGAAAAAAGGCTAAAACCACAAAGAAGATCGTG
CTGAGGCTGGAGTGCGTGGAGCCTAACTGCCGCTCAAAGA
GGATGCTGGCCATTAAGAGATGCAAACACTTTGAGCTGGG
AGGAGACAAGAAGAGAAAGGGCCAGGTCATCCAGTTTTAA
GCTGGGCCAAGTGCTTCTTTTGTGGATTACCATCGCTGTC
AATAAAAGTTGTATACAGTAATGATGACTTCTGTTTTATT
TTTAACATCAGCACCAAACTGTGCTTCCAAAATTAAATGC
ACTGTTGGGGGCCAAATCGCAGCTCTGTCGCCATAAATAC
TTTAAAAAGTGTTACTTCAACAACAGACCTGTTATGCATT
TTGTGCTGCTTTTGGTGAACAGCGAATTATGCATCCCTCA
GTAGAAGATGGATTCATACTTGAACTCACACTGTGTTGTG
TGTAGTCAGAGATGAAATGTGGAAACATGCTACACTTTCA
TTTTTAAGGTGAGGAATTGTACACTTAATGGACACTTATG
GATGTTATGTCTTAAGGCTTAACCTGTTTCCCCCTCTCTC
TAGTATGTACAGACACATTGTCAGGTCAACCCAGTTAAAA
TTGTGGAATTTGAGTAAAAACAACAAACTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations