ZFIN ID: ZDB-TSCRIPT-090929-4204
Transcript Name: sytl1-201
Previous Names: sytl1-001, si:dkey-228a15.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018812 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018812|OTTDARG00000015701|ZDB-GENE-060503-439 sytl1|OTTDARP00000015891 DKEY-228A15.3-001 LG_ CR749752.5 Danio rerio protein_coding KNOWN, 2706 bp
GGGTGTGAAAGTGCCAGTCCTGCCAAATCAGACACAAATG
AGTGTCTGTTCACAAACTGACGACAACTAAACTTGGGAAA
GAAACAAACACCGGAATAAACTATGCAGAAGACATTAGAT
GAGGTGTGTCTGTAATGGAAAAGGAACCTGTACTAGATCT
GTGTCACCTGACGGAGGTGGAGCAAACGGTAATCCTCAAT
GTTTTGCTGAGAGATGCTGAACTCCGCAGCCGAGAGGAAG
GTAGAGTCCGAAAGCTTCAGCAGACGGTGTCAGACCCGGT
GCATCTGCGCTCACTCTCTGGTGCCTGGTTTCACGAAGAA
CGTTCTAAGAGATACGAGAAAGGAGGAGCTGATGTTGTTC
ATGCTTCTTTACGCCGTAAGAGGCGAGGAAAAGATTTACC
TCTGACGGCAATATTTGATAAAGGTAATAACTCTTCTCAT
GTACATGAGCAGCAAGAGGAAGACAGGAATGCAGAGAGAG
ATTTGCAGGGAAATATGAATGAAAGAGAGGACGATAAGCA
TCAGGAACAGAAGGAAAGCGGACAAGAAGATGGGGAAAGT
CTCATTTCTAATGCCATCACTATACCACAATCCAGGACAA
GAAACGTCACAAAGAGGAATGAAATATTAGGCAGTGGCTT
TGAAGACAGTGTTGAAGAGTCAGAAAACAAAGAAAGAAGA
ATTTTGCCAAGCACATCACCAACTCTTCAGATTGACTCAG
AGGGAGACATTGACTCAGGAAGCACTGAAATAAACTATAC
TAGATTTGGCTCGGTTACCAGTTTGACTTCCCATCATATG
ATGAATGGCAGTCTGATGAGCCTGTACAGTGTGGGGGATT
TTGGGGATGTTGTCGTATCAGGACGGATCCAGTTCTCACT
GCAGTATGATGTCAGGACGGAGGAGCTTTATGTGCACATA
ATACGCTGCCAAGATCTTGCATCAGCACGCAAAAATCGAT
CAGATCCATATGTTAAAGTTTACCTTCTCCCCGACAACAC
TTCCCGTAGTAAGAAAAAGACTGCAGTGAGGAGGAAAACA
TTAAATCCAGTCTACGATGAAACCATGACGTACAAAGTGC
GGCGACTGGACCTCCCGGCTCGCGTGTTGAGTATGTCAGT
GTGGCACATGGAGAGAATGAGGAGAAACCTCTTCCTGGGA
GAGCTGGAGGTCAGGCTGGGTCAGTGGGACTGGAGCCAGA
ACCAGCCGACCTGGCAAAACCTTCAGCCAAGAGTTCAGTT
GAGTCCGGAAGCCATCATCAGCAGAGGAACCATTCTGTTC
TCAATTAAGTTTGTACCTCCTGGTTCAGAGGGACGTGGAA
ATCCAGCGACTGGTGAACTCCATATTTGGTTGAGAGAGAT
TGTCGGTTTACTTCCCACAAAACGTGGCGCACCTAACACA
TATGTAAAAAGTGTGGTTTTACCAGATGAGAGTGGTGTCA
GCGGTCAGCAGACTCGTGTGGTCCGTGGTTCTGTCAGCCC
AGTGTTCAATCACACCATGGTTTATGACGGCTTTCAGTCC
AGTGACCTCATTCAGGCCTGTGCAGAGATAACAGTCTGGA
ACCCACATCCCTCCGGCTGTCTGGGTGGAGTCCGCCTCAG
CACTGGCTCAGGCTTAAGTTACGGTCAGTCTGTTTGCTGG
ATGGACTCGACAGAAGATGAGATCAATGTGTGGTCAAGTG
TGATTCAGAGCCCCAACAGCTGGGTGGACACTAGTCTTCC
CATCAGAACCAACCTACAGCTCTGCTCTGACTGACCTTTG
CTGAACCTACTCCATGAATTTGCATCACATGACTTTAGAT
GTGTAAAGTTTCGAGTATGACCTGTTGTACTCTACATGAT
TTGTGCTCTACATTCTTTTTTATATCACTTGCAGTCTGAA
ATAACTAGTTGTCAGAGTTCAGACTTTCACAGAAAACACA
GTCTTTTGTTTATAGCTTCCATCCATTATATGGATAACAA
ATATGTTTGAGATTTTGAGTTGATTTTAGAGTACAGGTCT
CAACCTGGATTCCTGGAGGGCCGCAGCTCTGTACAGTTTT
GCTACAACCCTAATCAAACACAGCTGATCCAACTAATCAA
GGTGTTCAAGACTACTAGAGACTGTGATTTGGATGGGGTT
AGAGCTGAAGGCCCTCCTGGAATTGAGTTTGAGACTATTG
TTTTAGAGCATCATGATGTACATGTCAAAACTCACTCACT
GCCATTCACCTTTTAATAATGTAGTAATCAGTACACAGTC
TCAGAAATAAAGGTACGTGAGCTGTCACTGGGGTGGTACC
CTTTCAAAAGGTACACATTTGTACTTAAAGGGTCCACATT
GGTAACTCAGAGTGTATATTAGGATATAAAAATTTTAAGA
GGAACACTTTTGTACTTTTTAGGTACTGATATGTACCCTT
GAAGTGTTAATGCGGACCTTTTAGATACAAATTTGTAACT
TTTAAAAAGGTACCACCCCAGTGACAGCTCGCATACCTTT
GTTTTTGAGAGGGTAGGACAGGAATGAGACTGTCGTCCAG
ACTTTATTTTCTATTTTGCTTGGATTTGATGCAAAATATT
CCTCACTCATTTGATATGTATTACATTTTGATGAACTGTG
TTGTTGTTAGATTATATATTTTAGGAGTTGTTAAATTCTT
AACCTGAGAAGTTCTTAAACTGTGAATTGTAATTGTCATT
TTCATGAATGTTTTGAATAATTAAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sytl1-201 Contained in:
OTHER sytl1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018812 (1)
  • Ensembl_Trans:ENSDART00000102583 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC127388 (1) 2737bp
    GenBank:BM776334 (1) 607bp
    GenBank:AL911643 (1) 539bp
    GenBank:AL911644 (1) 539bp
    CITATIONS (2)