Transcript

phf14-201

ID
ZDB-TSCRIPT-090929-4177
Name
phf14-201
Previous Names
  • phf14-001
  • si:dkeyp-89d7.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018749 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018749|OTTDARG00000015647|ZDB-GENE-030131-1796 phf14|OTTDARP00000015828 DKEYP-89D7.1-001 LG_none BX530058.4,BX957232.4,BX276085.8 Danio rerio protein_coding NOVEL, 3492 bp
GACGTAATACGCAGAACATGAGCTGAGGAGGCGTTCGTTG
TACCTTTGTCCAAGCTAAACAAGAAAATCACACAAATGGA
TCGGGGGTCGAAGCGGCGGCAGGTGAAGCCTTTGGCTGAC
TCTCTGCTGGATGCTCTGGACTATGACAGCTCAGATGACA
GTGATTTTAAAGTTGGAGAATCATCAGGTTCAGAGGGCAC
TGGCAATGGCAGTGATGAAGAGGGCTCAAAAGAGAGCGCC
GCGGGCTCAGAGAGCGACTCTGATGCTGCTGCTGCCTCTG
CTGATGAAGAGGGCATAGACGACCTAGAGACCAAAGACTT
GAATCAAGAAGATGATGAAGAAGAGAAAGTCAAAGAGTCG
TTTTCAGAGGAGACCAGCAGCAAAGAAACAGGAGGAAGCT
CTAGGAGTCGCAAAAAGGGAGAAAAATCCTCTGATATGGA
ACCGAATGGTAGTGCTACGACAGAGGAAAACTCAGCAGAG
CCCAAAAAATGGAACCTACGGCGCAACCGACCCATGCTGG
ACTTCACTACGATGGAAGAGCTGAACGAAATGGATGATTA
CGACAGCGAGGATGACAATGACTGGAGGCCTACGCAGGGA
AAAAAAAAAGGCAAGGCATCATCTGGAAAGGAGAAAGAAG
GGAGTGGCGAAGAGGATGATGATGATGATGATGGTGGTAG
TGATGAAGAGGACAATGAGGATGATAATGACGATGATGAT
GATGATGATGATGAAGGTAATGATGACGAGAGCAGTAGCA
GTGATAGTGAGGAAGAAGGGAAGAAACCAAAAAAGAAAGC
AGGGAAAAACACAGGGGCGTTTGACGAGGAGGAAACCAAT
GACAGCCACAGCACATCTCATGGGAAGGGCAATGAGGACT
CTCTGTTGGAGCGGCCTCAGACCTGGAGCTCCCAGCGGAT
GGAGCACATCCTTATCTGCTGTGTGTGTCTGGGAGACAAC
AGCGAAGATGCGGATGAGATCATCCAGTGTGACAACTGTG
GCGTGACTGTGCATGAAGGATGTTATGGTGTCGATGGTGA
GAGTGATTCTATCATGAGCTCGGCCTCAGAGAACTCAACA
GAACCGTGGTTCTGTGACGCCTGCAAGAACGGTGTTTCTC
CCAGCTGCGAACTCTGTCCCAGTCAGGACGGCATCTTTAA
AGAAACTGATGCAGGGAGGTGGGTGCATGTGGTGTGTGCC
CTGTATGTTCCAGGGGTCGCATTTGGAGATATTGACAAAC
TGAGGCCGGAGTGCAGTTTGTGCGAGGACACGCGTTTCGC
TCGAACAGGCGTTTGTATCAGCTGTGATGCCGGGATGTGT
CGCTCTTTCTTCCATGTCACCTGTGCTCAGAGAGAAGGCC
TGCTGTCTGAAGCTGCGGCAGAAGAGGACATTGCAGACCC
ATTCTTTGCCTACTGCAAGCAGCATGCAGACCGCTTTGAC
AGGAAATGGAAGAGGAAGAATTACCTGGCCCTGCAGTCCT
ACTGCAAAGTGTCCTTGCAGGAAAGAGAGAAGCAGCTCAC
ACCTGAAGCTCAGGCTCGTATAACCACGAGGCTCCAGCAG
TACAGGGCAAAAGCAGAGCTGTCTCGAAACACTCGGCCGC
AGGCATGGGTGCCCCGAGAGAAGCTTCCCCGACCTCTCAC
CTCCAGTGCTTCAGCCATCCGGAAGCTGATGAGGAAAGCC
GAGCTCATGGGAATCAGCACAGACATCTTCCCCGTGGACA
CATCTGATATCAGTGCAAGCGTGGATGGACGACGCAAACA
TAAGCAGCCTGCTCTCACTGCAGACTTTGTGAACTACTAC
CTTGAGCGGAACATGAGGATGATTCAAATCCAGGACAACA
TCGTGGAGCAGAAGAACCTCAAAGACAAGCTGGAAAGTGA
GCAGGAGAAACTGCACATGGAGTATGATAAGCTGTGCGAG
TCTCTGGAGGACCTGCAGAATGTCAATGGCCAGCTGAGGA
CCGAGGGCCAGTCCATATGGAGCATGATGGGGGGGATCGT
TGGACAGAAGTTGAATGTCCCTGCAGTTCTGAAAGCTCCG
AAAGAGAGAAAACCAAGCAAGAAAGAGGGAGGATCGCCAG
GGAAGTCATCAAGCCTCCCAGCTATGCTCTACAGCTGTGG
GATTTGTAAGAAAAACCAAGACCAGCATCTTTTACTGCTG
TGTGACACCTGTAAGCTGCATTACCACCTGGGCTGCCTGG
ACCCTCCGCTCACACGCATGCCGAAGAAGACCAAAAACAG
CTACTGGCAGTGCTCTGAGTGCGACCAGGCCAGCAGTGAC
GAGGCTGACATCGCCATGGAGACACTACCAGATGGAACCA
AAAGGTCCAGGAGGCAGATCAAGGGACCAATCAAATTCAT
CCCTCAAGAAATGAGCCCGGAGCCCAAGAAGCCTCAAGTA
AGAGGGACTAGAACCAGAGGCCAGAAGAGGAAGAGGATGT
CCATCTGTGAGGAAGAGAAGATGGAGGAACCACTGCCGAG
GGAGCGTAGACAGAGGCAGTCGACTCTGCAGAAAAAGCCC
AAAGCCGATGACACGCGGACCGAGTGCACCACCTGCAAGG
GCCCGGGCGACAATGAAAACCTAGTGAGGTGTGATGAGTG
TCGGCTCTGCTACCACTTCGGCTGTCTGGACCCTCCCCTG
AAGAAGTCGCCCAAACAAACAGGTTATGGATGGATCTGTC
AGGAATGTGACACCTCTTCATCTAAGGAGGAAGAAGCACA
AGAAGTTGAAGAAGAGTCTGTGAATGAGGAAACAGCAGAG
CAGGAAATCCCAGACTGAAAAAACTGACATGAAGTAACTG
AACTCACTTCCTGCTGAATGGCGGGATTCAAAGTACTAAA
CAACACACAAGAACTGCCACTGCTTTACCAGACTACAGCT
GTAATATTTGATTACCAGTTTCAGGATGAAATGATCACAA
TTGTGGATGCTGTGATCTCCTCTATATATCTTATTTTCAG
ATATATTGTACAGCGTCTGCCGTCATGCAGTGCTGGAAAC
AAGTGGCATGGTTTCTGACACTGTTCTCAAAGATTATTTT
TTCATACACTAATTTTGAAATTTGCTATGAGGGTATGAAT
GTCATATATGTATTTGTGCCCATCCCGTAAACGCCTGTTT
GTTAATACGCTTTTTATATTTGCCTTCATTTTTTTATTAA
CGCCAAAGCACACTATGTGAAAACGAACACTGACAGAAAA
GCTGACCGTCATCGTCTCGTGTCGTATAAATAATTCAATA
CATCTTGATGATGAGAGCAAAATCTATTTTATTATTTTGT
TTTCTACAAATCTCACTTTTATAACTACAGTATATTCCAG
AACATGCTTTACCATTGACGGTGTTGATGTCCATGTTTGA
GGATGTTCTCAGTTTGAGTGTAAAATAGTAAGACAAGTCA
TCTGCCTCAGCGATTTCAAGATTTGAAGTCTGTATTTAGG
TACTTCCAAATAAGAAAAGTGACCTTCATAATAAACATTG
TGATTTCTATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations