Transcript

nxph1-202

ID
ZDB-TSCRIPT-090929-4174
Name
nxph1-202
Previous Names
  • nxph1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000018746 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018746|OTTDARG00000015644|ZDB-GENE-040718-231 nxph1|OTTDARP00000015825 DKEY-14G9.1-001 LG_ BX571820.5 Danio rerio protein_coding NOVEL, 810 bp
TGCCCACGCTTCTGTCCCGGGGAAGTCGGAGCTGCTCAAA
TCAGGAAGCCCCAAGTCAACGCTAAAGCATATATGGACAG
AAAGCAGTAAGGACTTGTCCATCAGTCGACTTCTGTCACA
GACTCTCCATGGGAAGGAAAATGCAACAGCCCTGGATCTG
CACTATGACACTCCAGAGCCTTACTCGGAGCAGGACCTGT
GGGACTGGCTGAGGAATACCACGGACCCGCAGGACTCCAG
GCCCCGAGCTAAACGGCGGCCAATGGTCAAGACGGGCAAG
TTCAAGAAAATGTTTGGCTGGGGAGATTTCCACTCCAACA
TCAAAACAGTCAAGCTCAACCTCCTGATCACCGGCAAGAT
CGTCGATCACGGTAACGGCACCTTCAGCGTCTACTTCCGC
CATAACTCCACGGGCCAAGGCAACGTGTCCGTCAGCCTGG
TCCCGCCCACCAAAATCGTTGAGTTTGACTTGACAGCCCA
GCAGTCGGTCATCGACGCCAAGGATTCCAAGTCCTTCAAC
TGCCGCATCGAGTACGAGAAGGTGGAGAGGGGTTCCAAGA
ACACACTCTGCAACTTCGACCCATCCAAGACATGTTTCCA
GGAGCAGACGCAAAGCCACGTGTCCTGGCTCTGCTCGAAG
CCCTTCAAAGTCATTTGCATTTACATCTCCTTCTACAGCA
CCGACTACAAGCTAGTGCAGAAAGTTTGCCCAGATTATAA
CTACCACAGCGATACTCCTTACTTCCCCTCTGGCTGAAGG
TAGTCGTTGATCCATATGAAGGACAACAAGAGGCAAAGGA
TGGAGCTCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations