ZFIN ID: ZDB-TSCRIPT-090929-4103
Transcript Name: grn1-201
Previous Name: grn1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018504 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018504|OTTDARG00000015443|ZDB-GENE-060103-1 grn1|OTTDARP00000015626 grn1-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 1618 bp
AGATTTCCTGTTAGTATAAATCTCAACAACAAATCTGATG
AAGTTTCCAGTAATTGCACTGGGAGGAGTCTGTCTACAAG
TATAAGAAGTACAGCAGAGAATTACCGGACAGAACGACAC
AGACAGCAGCAGAAGCATCCCGAACAGGAGGAAACCCAGC
CAGCAAGATGTTCCCAGTGTTGATGTTACTCATGGCGGCT
CTGGTGGCTGCAGATGAGCCTCTGCTTGATCTGTCTATCC
CGGTGGAGACTGTAGACACCTCTGCCTCTGTGATTTACTG
CGATGCTCAAACTGTGTGTCCAGACGGAACAACATGCTGT
CTGAGTCCATATGGCATATGGTCATGTTGTCCTTACTCAA
TGGGTCAGTGTTGCAGGGATGGGATTCACTGTTGTCAACA
TGGATATCGCTGCGATTCCACCTCCACCCGATGCCTGCGG
GGCTGGCTGACTCTGCCATCGTCCTTCCAGAAGGCCACCA
GAACCTTCCAGAAAGATCAGACCCAGGCTGAGACTGTCCA
ATGTGAAGGAAATTTCTACTGCCCGGCTGAGAAGTATTGC
TGCAAGACTAGAACTGGCCAGTGGGGCTGCTGCAGCGGGT
TGGAGTTGTAATCAAACAACCACTGTTACACTGGTTCACC
TCTTACTGAAGACTGTCAAAATGCAAGAGGCTCCAAACTT
CATTCATGTTTCAGGCTATATTCTTACATCCAGGCTGAAT
TAGTGTGAAATAAAAACTAATAGAATTACTGTCAAAATGC
ACCGTCATTTAATAAACATTATTAATTTGGGGGAAAAGAA
ATTGTGTTCTTATTCATTCATTCATAGTATTTTTATGAAG
TAATCAGTGATTGTGAATGAATTTAATGCACTGTAAAGCC
CAACAGTCCACTTTATCAAATGAATTGAGTGAAAGAAATG
TACAATATAAATCAGGAAGTGATATTACAAAGTGATAAGA
ACAATAAGTAAAAAAAGAAAAAAGTAATATGAAGAAAAGA
AAAGAAAGAACAAAATGAAGAAAAGGCAAGTACAAAATTA
AATTAAGAAATTAGAAATTAGAAATACAGAAAGCATTAAT
TACTAACATCCTGGAAGCATGATATTTTCATAAGTTTCTA
TTGACTTGCAGATTTTTGTTGTTGTTAGATAGACGTATAG
CTTTAAGCAAGAAATCAATTTCAATTAAATAATGGGCAAA
TGAGGGAGAGGATTTAAGAAATTTTTGTTTGTGGATAAAG
AATTTAGCAAATAATATTAAAAAAAAGTTATAGAAATATT
CTTCATTTTTATTCTTGGGGCTTAAATAACAACAAATGAT
ATTTTTCAGTTTAAAGATTTGTTTTGTTGATTGGGATTTC
TTCAAATAATTACATAGATCTGACCAAAACAGTGAGATTT
TACATGTAAAATACATGCGAGTCAAAGTTTCCTGATTTTC
CTGACAAAAGGAACAAGTATCTGCAATATCAGTAAATTCT
AAGATAAATGCATTGACCGGGTATATTTTGTGTAAAGTTT
TAAAATGGATTTAATTTGCTTTGTTTGGGATTACATATTT
GAATGGGAGAAGCATGTTCTTTTCCAATCAATATCTTCAT
TAAAGCTGACCAATATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grn1-201 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018504 (1),  Ensembl_Trans:ENSDART00000051972 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC153543 (1) 1511 nt
GenBank:CN504392 (1) 804 nt
GenBank:BC116498 (1) 707 nt
GenBank:BG884011 (1) 475 nt
CITATIONS (2)