ZFIN ID: ZDB-TSCRIPT-090929-4098
Transcript Name: rbm48-201
Previous Names: rbm48-001, dkfzp564o0523-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018479 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018479|OTTDARG00000015422|ZDB-GENE-060328-1 rbm48|OTTDARP00000015602 dkfzp564o0523-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 1203 bp
CGGGCTTTTATTTATTTTTTCTAATTGGAACTTTTATTTT
GAAAGCCTGTTTTTTTTCGTCGCTGATTTCCACAGTGATG
GACGGGTCAGTTGCTAGTTCCTCTGTGTGGGACACACAAA
AAGTGTATAAACATCACGAGCAGCAAAATGTTGCCCAAAC
GCGACCAAAATACAGAGAAGGAAGACGCCTCAAAGCTGTT
AAGGTGTACACCATCAACCTGGAGTCTCGGTATTTACTAG
TTCAAGGAGTGCCCGCTATTGGAGTGATGGCTGAGCTGGT
GCAGCTGTTTGCTCTGTATGGAGTGATCGAGGAGTACAGG
CCACTGGATGAATACCCAGCAGAAGAGTTCACTGAGGTTT
ACTTAATTCAGTTCCAGAAGTTGACGAGTGCACGGGCAGC
TAAAAGGCACACAGATGAAAAGAGCTTCTTCGGGGGTCAG
CTGCATGTCTGCTATGCTCCTGAGTATGAAACCGTGGAGG
AAACAAAGCAGAAATTACAAGACAGAAGGAGATATGTTAA
CTGGGCAAGCCGAAATGCAGCACAACTACACAGTCAGCAA
GCGGAAGTAAACACAGAGTCATCATCAAGCACAGACACAC
GAACAGCTGAAGCTCCTAAAATGCAGAAAAACCCTGAAGA
AGCCAGAAGGGAGAACGTAAATTCTGACTATATGGGATTT
CCTCTGTTGCCTTTGCCTCCAACAGCAGATATTTCTTATA
GACTTCAAAATCATTTTACCCAGCCATCACAATTACAGTG
GACCAATGAAACGACAGAGGATAAAATGGGCTCTCTGCAT
AATTTCATCCCTCCTGTACAAAAAACCTCAACGCAGAGTG
AGTCTTCCTCATCTTCAGGTGTTAAAGAGGGAGATTTGAG
GCAAAAACAGAAGATTTCCACTCCGTCTATTAGATTTATG
CCAAGGACTACACATTTAGAGAGCAGAAAAAGGAAACTAG
ATGAACAAACCTTCTTTTTGAAAGAAGCAGATAAAACGGG
GGTTCTGATTGGTCCAAAATTACCAGAGCTGCCCAAGTTG
GACATGGAAGATTCTTCGTTAAATGTTACCGCCAATTTGA
TCCGTAACACCATGACCAAGGCAGCATCTGTTCCAGAGGC
TAAACCTGTTCTAGCAAAGCACACTACACCAAAACCACGC
AGAAGAATTTAAGAAGACAATAAATGTCTTGCAATGAACA
GTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbm48-201 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018479 (1),  Ensembl_Trans:ENSDART00000049147 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091857 (1) 1173 nt
GenBank:EH551204 (1) 944 nt
GenBank:EH572338 (1) 875 nt
GenBank:CO925519 (1) 778 nt
CITATIONS (2)