ZFIN ID: ZDB-TSCRIPT-090929-4097
Transcript Name: zmym4-201
Previous Names: zmym4-001, si:ch211-173p18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018478 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018478|OTTDARG00000015421|ZDB-GENE-030131-5459 zmym4|OTTDARP00000015601 CH211-173P18.1-001 LG_none CR749172.5,BX510986.8 Danio rerio protein_coding KNOWN, 5255 bp
GCTGCACGCATAGGGGGAAGTGGTTTCGCGGGAGAGCCTG
CTAGTCTTTCCAGCTAGTTGGTCCAGTTTAACTTTATCCC
CTCATCTGATGTATTGATGCAGAAGTGAGCTATCGTGCGT
CCTGCAAACGTCGTGTGCTATTACTCATCTGAGGAGGCTT
GTCGACTGAACACGCTTGAGTGCTTTAAAGAGCTAAGTCT
GGCCCATCACCATCTGCAGAGTGGGTTTCACCACTGCGCT
CTCCGTCTGCAGCCGGTGTTTACATGTCTACTGAGGATTT
TATAGGAGGAACAGCAGAGTCAGGGAAGATGGACACCACT
GAGACTGATGCAAATGAACCTTTCATTGAAAACATGCTGA
TGGAGTGCCATCAGGTCGACGAGGAGGAGATGGAGGAAGA
GCATGAAAGCAGAACAACAAAGAATCAGAAGGAAGTTGAA
GAACCAGAGTGTTCAGCTGAATTTGTGGCCGCTAAAGTGG
AGGACTTCACTAATGAAATGTCCAGACCAGAGGATGCAGA
CATTAAAATGGAGAGAACTGAACCATCTGCATTGCAAACA
CAATCAGCGGTAAAACCTGATATGAAGCCTCAACAGCTTT
CCGTGGACCTGCCGATGAAGGTGAAGGACGAGCCGATGGA
TGAGGAGTACGAGAAAGCATCAGTATCGCTGCACACAGAG
GGAGACATTAAAGATGAACCCGACACTGCAGCGGACAACC
AGACTGGTGCCATTAAGATCAGTGCAGTGTTTTCTGTAGG
AGGAACTCCTGCACCCATTGCTCCAGCCAATCCGGTCGGT
GTGGTTTGCACAGGGTGTAATAAAATCCTGCTGAAGGGAC
AGACGGCTTTCCAGCGCAAAGGCTGTCCTAAACTCTTCTG
CTCACCTCAATGTCTCTGTAGCAACTCCAATGTGGTGGTC
AAGATGCCTCCCAAGAAATGTCACTTCTGCCTCAAAGATA
TTACTGATTCTAAGGATGTGATCAGTGCACCGGTGGATAT
GGCAGGGAATCTGAAGGAGTTTTGCAGTCAGAAATGCATC
AGTTTATTAAACTTCAAGTGCAGTGTGTGTCAGAAGGCGG
GAACAACTTTTACTCACAAAGTGAACTTGATGGACTCCGT
CCATATTCTGTGCAGCGACGACTGCTTCAACCAGTTTCGC
ACCTCCAATAAGCTGAACGGGAACAGCTGTATGAACTGTG
GGGGAATCTGCTACGGCACAGACGCTCCATGTCAATCTCT
GCAGATAGAGGGCATCGTTATGAAGTTCTGCAAGCCGAGC
TGCCTCACAGCCTTCAAAAAGAAGAGTCTGAAACCTGTCG
CTTGCAAAATTTGTCGCACTTTGCACCCGGTTGCCGAAAT
GCTGGAATGTATGAACGCAGAGGGAATCCGAGAGATTTTC
TGCTCTGCCGCCTGTGTCACAGCGAATAAAGTTCAGACTG
TCAGTTCTTCAGGTGCTCCCGTGGAATGCAACAGCTGTAA
GCAGAAGCTGGTGCCTCAGTACCATCTGGCCATGTCTGAT
TCAAGCATCCAGAACTTCTGCTCCTTTTCTTGTGTAGTGT
CATATCAGGAGTCATTTGGTAAGAAACCAAACTACCAGGT
GAACACTGTAACCTCTACGACGAATGCATCAACGCCAAAA
CCTGCCTCTTCAGAGTCCAGCTCCTCAACCAAGACAAGCA
CTTCCAAGAGTCAAGTTCAGAACGTCACAAAGATCCCCTG
CTCACAGTGTCTCAACTCATTCTTCCACAAACCAGAACTG
CTGGATTTTAAGAGGAAAATGTACGCTTTCTGCGGTACGG
CTTGTGTTGAGGAGTTCAAGCAGATCAACAACGTCATGGC
TCGCTGCGAATACTGCAAGATTGACAAAATTATCAAGGAG
GTGAAAAGGATCAACAAAATTGACCGATCTTTCTGCAGTG
AGGGATGCAGGTTACTCTATAAGCATGACCTGGTGAAGCG
CTGGGGGAAGAAACACTGTCGCAATTGTTTGTACTGCAGC
GGCTCGGCTCAAACCGTAGTCAGCGCAATCATTAATAATG
TTGAGGAGGAGTTCTGTGGGACCATGTGCTTATCGCTTCA
TACCTCATTATTGCGGAAGGAGATCAAGTGCTCCATGTGC
AGACAGGCCAAGAAGATGACGGAAACGGTGAAGTGGGTGG
GAGAGATTAAGCATTTCTGCAGCTTGCAGTGCTTGATGTT
TTTCTGCAGTCTGCAGGGCACCACTGGGACTGTCAAACCT
CAAATCAAACCTCAGCCCACTCAAGGGACAAGCCCAGCAC
CTTCTCCAGCCCCTCAAAGTACAGTTAATCTGGTGTCACC
GACCACTAAAGAGACCACGCCAGTCATTGCCAATGTTATC
TCGCTTGTAAATGCATCCAATGGACAGCCGACGGTTTTGG
GAAACAGTGTTTTGCAAGCTTCTGTTCCAGCTGCTGCTAC
AAAAAGTTCAGGAAATACGGCCAGCACACAGACAGACAGT
GTGAAGCCTTCTGCTCCTCCACCTCGAATCCTGAAAAACA
AAGCCTTACTGTGTAAACCCTTAAGCCAGAACAAGGGCAC
TTCCTGCAAACCCAATGTCTGTGACATGGATTCACAAACA
GAAGGACCTGCTGTTATAGTGCTTCCTGTGCCGGTGCCCA
TTTATGTTCCTGTTCCTATGAGTCTCTACACTCAGTACAC
GCCAAAATCTGTAGGCTTGCCACTGCCGGTTCCAGTGCCC
TTGTTCTTCCCCACGACACTGGACAGTGCAGAGAGCATTG
TACAGACCATTCAGGAAATCAAAGAGAAGATCCCTGATGA
TCCTCTGGAGGCCGACCTCATTATGATGGCGGAGATGGTG
GCGGAGGATGCAGAGAAGGAGAAACGCATCAGCTCCACTG
ATCAGCCTGTACACATAATGGAGGACCTTGATCTGGAAGC
CCTGTCCAGTAATCTGAGCTGGGAGGAAGACTCTGTGTCT
TCTGCTCAGACATGGGATCAAGCTCCAGAGCCGGAGCGTT
TTCTTCCTCCTCCGTCCAGATCTGCCACAGTTACTCCCGT
CTCCAGCACAGCAGAGGAGCCACAGATGGACCTGGAGGCA
GATTTCCCAATCGAGAGCATTGAACTCTTCAGAGAACAAA
CGCCAAATAAGACAACAGGCAAACGGAAATCTCGCAAGAG
AGCACGCGATGGCTTTCCTCAGAAGAAACGGGCTGTTTCA
TCCGCATGCACATTTATGTCAGTGAAGTCAAGTCTTGATG
TCGGCAGTGCTGGTCTGCAGGCACAGAAAACGCCGGGATC
CTCAAGTCATAGGCTGATAAGACGAGACGCAGTGATTACT
GGACTGAGGAGGGAGCTGCACCACTGCAAGGAGGTTTATG
AGACCACCAAAGCAGCTCTGACCGATCTGAAAAGCTCTCA
TAAGGGGCTCGTGGAGGCACACATGGCTGTGGTTCTGCAA
CTGAGAGATGCACTGGACAAAAAACAACCACTACGGACCC
AGCGTCATAGTTCATGCAGTCAAGATGATATGATGCAAAC
AAAGTCCTGCCATCCCAATTTCGACTTTCATCCTCCCTCA
AAGCAGCAGTTGAACGCCCTGTTTAATCAGAGTCAGAAGC
GTGCGGATCGTTACGGATGCCTGCTATTTCGTGTCATTGT
ACCTCAAACCAAGTATAAAGAATGGGCGTCCAATACCAAC
TGGGATGGCTCAAGGGGTAAATGCGCATTGCCGGTAAACC
TGCGGAGCTTCATCATTGATACGGTTTCTCAGAGATTCCC
CGGCTTGAGTGATGTTGACCGGAAATGCATTAAAGACAGA
ATCAATGAGTTCTTGCGCTCGCCAAGAAACACGGCTCGTA
AGACTGCAGCAGAGCTTCCAGCCAAATCAGCTCCAGAAAA
CCTCTCTAACATCTCTAAACTACAACACGAGTACGGAGTC
ACCGCCTGGAGGGACTGGGTGCGCTGGAGGAACGCTCAGC
CCAACATGGAGACTCCCAAATTTGGCTCACGCAGCATGAC
ACTGAAGGAGGACCTGTTGAAATGTTGCACCGCTGAGATA
AGCTACGGTCTCTGTAAGTTCATCACTGAAGTCCGGCGAC
CCAATGGAGAGAAATACAGTCCTGACAGCATCTATTACCT
CTGCTTGGGCATCCAGCAGTACCTGTTTGAGAACAGTCGA
ATGGAGAACATCTTTGCAGACGTCTTCTACACTAAATTCT
GCCAGGAAATGACCAACATACTCCGTGACTGGAGACCAAC
TGTTTTGCCCAGTGGTTATATTCACTCTCGTGTGGAAGAG
GAGTATCTGTGGGACTGTAAGCAGCTCGGGGCCTTTTCAC
CTGGAGTTCTGCTCAACACTTTAATCTATTTCTTCACAAA
ATACTTTAACTACAGGACAGCGGAGCAGCACCGTCTCCTC
TCTTTCGGCCACATCGTGCGCTGCTCTCGGAGCAAAGGCA
ACACAAAAGTGGCCTGTTTGCGTTTCTATCCTCCGAAAGA
TGAAGCCGACGGCGTTCCGGCAAAGAGGAGGAAAGAAGAG
GGAGAGGAGGAGGATGAAACTGTATATGAGATAAAGGAGA
ATTCAGACAATCCTCTCCGCTGTCCTGTCAGGCTCTATGA
GTTCTATCTCTCAAAATGCTCACCGAGTGTGAGACAGCGC
ACGACTGATTTCTACCTGAGCCCCGAGCGCTCCTGCGTGC
CCAACAGCCCCATGTGGTTCTCCATCAGCGCTCTGAGCGA
TGAGGCTTTAAACAGCATGTTAACCCGCATCCTCACAGTC
AGAGAGCTCCATCTGGACACAGAAAAAACACCCGCTGACA
ACGAATCAGACAGCGACTCCGACTTCAGTCCGTGATGCTG
AAAACGGTCTTGGAGAAAAGGTTTCTCTTTGGTTCTTCAC
TGACAAAACCTAGACACACCAGTGAACTGGCTTTTTGGAG
ATCCTTGGAAAGTGCTTTGTCAGTGCAGTTTCCATAATTG
AAGTATAATGATATGCTGGGGTCACCGAAAACATTTCAAA
AAGTGCATTTGGTTGCTCTAAAAAGGACAGAGCTGAGTTT
AATGCATTGCCAGATTACACACAAGGGAACTTTAATGGGA
TCGCTGAAGATTCTTTGTATTATATTGAAACACTAAAGAG
ATTGACAGCATCTACAGCAGGTATTAATAACCGTGACTTG
GTTATCTGCCCTTTGTGATTGAGATTATGTTTTTGTTTTT
TATTTGCAACATTACCGCTTATCATGATTTCTTCCTTTGG
ATAAAAAAATTACAG

zmym4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zmym4-201 5255
zmym4-202 (1)    Ensembl 4346
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zmym4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000018478 (1),  Ensembl_Trans:ENSDART00000140926 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG576160 (1) 933 nt
GenBank:CK704311 (1) 794 nt
CITATIONS (2)