ZFIN ID: ZDB-TSCRIPT-090929-4092
Transcript Name: illr4-201
Previous Name: illr4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018473 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018473|OTTDARG00000015418|ZDB-GENE-050311-5 illr4|OTTDARP00000015598 illr4-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 986 bp
GTGATACAGGCTTTGAGCAGCATCCCTCCAGAAGCATGTC
TGAGGACGTGGTTTATTCAGAGGTCGTGTTTGTGAAGAAG
AAACAGGCGGACAAAGATGATGAAGATGATCCAGATCAGT
GTGATTTGCAGAAGAGGCGCTCATGTTGTGATGGTGTTCG
GCTGGTACTGACGGCTCTGTGTGTGATCTTCACCACTGGA
CTGATCGCGCTCAGCTTCTTGTGCTATATGCAGGCTACGT
CAAACCATAACTTTCAGAAAAAGCTTCAAGATCTTCAGGA
GGTCCACAATGCACTGCAGGAGAACTTCACAGCATTTTCA
GCAGTGCTCGAACACATATATAACAGGGAACAAAATCTGT
CCCGGGCTCTGAATAACAGTGCTCAATGTCCAGAGGACTG
GCAATATCATGCAGGAAAATGTTACTACTTCTCTTCAAAC
ACAAACACACTGGATTGGTTCAAAAGTCGAGATGCCTGTA
TTTCAGACGGCGGACATCTGGTGATCATAAACAACAGAGA
TGAACAGGAGTTCCTGATGAGCAAAACAAACAAATATAAA
GGCTCGTTCTGGATTGGGCTGACAGACAAATCTACTGAGG
GTCAATGGCTGTGGGTGGACAACACGAAGCTGAGTACAGA
TATACGTTACTGGAATGGACAGGAACCAGATAACTGGAAA
GGATATCGCAATGAGTACACTGAAGGAGAAGACTGTGCTC
GCATTGAACAAAACAACTGGAACATTAACAGCTGGTTTGA
TGCATTCTGCACTATTGCATTCAGAAGAATATGTGAAACC
AGATCCTCCAGATAAGCATAGTGGGCAAGGAAAGAGATGT
GTCAAATATAAATGTATGCTCATGTCAAGGGAACTCCACC
ACCGCTGCTTTAGAACCTCATGATGCTTTAGTTTTGACTT
TCTTTCGCCAATGTTTTGTGCTGCTTGCAAGTTGTGAAGC
AATAAAGTCACTCATTTGAATCTCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
illr4-201 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018473 (1),  Ensembl_Trans:ENSDART00000102904 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124080 (1) 1015 nt
GenBank:AY986758 (1) 964 nt
GenBank:CO802635 (1) 779 nt
CITATIONS (2)