Transcript

rab42a-201

ID
ZDB-TSCRIPT-090929-4030
Name
rab42a-201
Previous Names
  • rab42a-001
  • zgc:73061-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018172 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018172|OTTDARG00000015172|ZDB-GENE-040426-1983 rab42a|OTTDARP00000015329 CH211-245H7.3-001 LG_ CR385068.11 Danio rerio protein_coding KNOWN, 1090 bp
TCTTCTCTCCTCTCCGCTCCATACTGCCCAATGTAAACAC
CGTTAGCGCTCCTGCTTTGTCTTTGAGTCTGTGGCTGGAG
CTTTTGACTCGCCATGCCATGGATACTTTATGGCAGTACC
AGTTCAGGATAATTTTACTCGGGGACTCGACGGTGGGCAA
ATCATCTTTGCTCAAGAGGTTCACGGATGGCATATACAGC
GATGTAGCGGATCCGACGGTCGGTGTGGATTTCTACGCCC
GTTCAATAGACATCGAACCTGGGGTTAAAATCAAACTACA
GTTATGGGATACAGCCGGACAGGAGAGATTCAGGTCTATC
ACCACTTCCTACTATCGCAACTCTGTGGGCGGTCTCTTAG
TTTTTGATCTGACGAACAGGAAGACCTTTGATCATGTGCG
GGAATGGCACCGAGAAGTCAGCGAGCACATCCTGCCTCAT
CACATGGTCTACATCCTGATCGGCCACAAGAGCGACCTGA
GCCGCGATCGCAAGGTGACACGAGATGAGGCCGAGCAGCT
AGCGGCCGATCTCGGAATCCGCTATGTGGAAACATCAGCC
AAATGCAACAGCAATGTGGAACGTGCTTTCGAGCTGCTCA
CACGGGACATTTATGAGCTGATGAAGATGGGTGAGATCTC
CACTCGTGACGGCTGGGATGGGGTCAAGAGTGGCCTCACT
GCCAAAGTTCTTTATCCAGCTGAGGAGGAAGCGGAGCGAG
AAAAGAGCTGCAACTGCTGACTTCCACAATCCACCTGTAA
TTGCACCTGTGTTTCAGTTGGTCGTCGCTCACCTTGGCTT
TCACCAGTGTGTCGCATCATGGTCACTGCCTCAGGGCCTG
GACCGCTGCACGTACCTTCTTGTTGATGTTTGAGGTTGAT
GGTATAAGCCACTCAAAGGTGTAGTATATGTGGGCTTGAA
TGGTCCTCTTCATATTGTTGGAGATCACCCTATGTTTTCA
AGTCTTGTGGATAACATGGATAAACATTTTTTAAGCTCTA
TCCCATTGTACTTCACATCCTCTGGAGTTTAGTCTTCTTT
CTTTCCCTTTTAACATTATTACTGTGGTACAGTTAACGTC
TAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations