Transcript

hoxa13a-201

ID
ZDB-TSCRIPT-090929-4010
Name
hoxa13a-201
Previous Names
  • hoxa13a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018123 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018123|OTTDARG00000015141|ZDB-GENE-990415-5 hoxa13a|OTTDARP00000015294 hoxa13a-001 LG_ CR382300.12 Danio rerio protein_coding KNOWN, 1669 bp
CGTGATTCTGGATGTACGAGGGTGCGTCAGAGTCAACTGT
CTCCCCTTTTCAGTGTCTAAGCTTCACAAAAAAGAGCCAC
ACGTCTCAATGTCCGACGGGCTATGACAACGTCACTACTT
CTCCGCCCGCGCTGGATTGACCCGGTCATGTTTCTCTATG
ATAACGGTGGCGGTTTAGACGACACCAGCAAAAATATGGA
AGGGTTCACAGGAGGTAACTTCTCGCCAAGCCCGTGCAGG
AATTTGATGTCTCACCCTGCCTCTCTTGCGCCCAGTGCTA
CTTATCCGTCCAGCGAAGTGGCTGCTGCTGCAGCGGGTGA
TTCTGGAAAGCAATGCAGCCCCTGCTCAGCCGTTCAAGGT
TCAGCCAGCGCCTCAATTTCCTATGGATATTTCGGAGGCG
GTGGATACTATCCTTGCCGAATGTCCCACCACCATGGGAG
TGGTGGAGGTGTAAAGACATGCGCCCAGTCCCCTGCCTCT
GGTTCACCTTACGGAGAAAAATACATGGACACATCAGCTT
CTACAGGCGAAGATTATACCAGCTCACGCGCCAAGGAGTT
TGCCTTGTACTCAAGCTACGCCTCAAGTCCATATCAACCA
GTTCCGAGCTATCTGGATGTTCCAGTAGTCCAGGCAATAA
GCGGGCCTTCGGAGCCCCGACATGAGTCTTTACTGCCGAT
GGAGAGTTACCAACCGTGGGCAATCACAACCAGTGGATGG
AACGGACAGGTCTACTGCACCAAAGAGCAGCAACAAACGG
GAAACGTGTGGAAGTCGTCAATACCAGAGTCAGTATCCCA
TGGAGGGGCAGACGGCAGCTCCTTCCGCCGCGGAAGGAAG
AAACGTGTTCCATATACCAAGGTGCAGCTGAAGGAGCTTG
AACGGGAGTATGCCACTAACAAGTTTATCACCAAGGACAA
ACGCAGACGGATATCCGCTCAGACCAACCTATCTGAACGA
CAGGTCACTATCTGGTTCCAAAACCGACGGGTAAAGGAGA
AAAAAGTTGTCAACAAATTAAAAAGTAGCAGTTAGCTTTG
CTCTGTGTAAATGTAAGGGAACTATTTTTTTAACAATGAT
GCCCCCAAATACACACAGAGAGAGAGAGAGAGAAAGAGAG
AGAGCTATGAAAGTATAGACGTTTAACGAATATGTGTTTC
CTTGGACTACTGCTTTTGAAGTGGCCACTTTGGATCGCAC
AGGGTTGATGGTGACGCGGTGCGTCATTTCTGCACTTCAG
TGCATGGCCATATTCCCAACTCAGGGCAAAAACGGCCAAA
GGATGAGTTGTTTGATGAGATTTAGTCACTGCTCAACAAA
ATATCTCATAAAGAATAATACATTGGATGTGTAAATGTTG
AAACCGTAATTCTTTACGGTGTGGTACGATTTTTCTTTCA
CCACTCCCATGGTCGATTAGAATCAAAATTATGCTTTGCT
TGAAATTCAAGTTCATGAGATTTCGTGGAATATTTGATGT
GGAGCCTGCAGTTTATCAGTCACGTGTACATATCAGTGAC
ATGTACAATCTTTGGCTATATTTGTGCAAAACAGGCCGTG
AATACTATAAAATGGCTGTTCCTGTAAAAGAGTGTTTTAT
TTTATTTTTATTTTTTTCGTTGTATAGTGTTTGCAAAATC
CCTCTTAATAAACTCTAATTGAAACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations