Transcript

sytl3-201

ID
ZDB-TSCRIPT-090929-398
Name
sytl3-201
Previous Names
  • sytl3-002
  • ottdart00000004944
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004944 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004944|OTTDARG00000004625|ZDB-GENE-040724-150 sytl3|OTTDARP00000004486 DKEY-37J22.1-001 LG_none BX293547.6,BX510905.7 Danio rerio protein_coding NOVEL, 2130 bp
ACAATCTCTTTGTCTTCTGAACAGATTTCTGAGACTGGGC
AGAGAAGTGTCTTCTGAACTAAACTCTGGATGAAATGAAG
CTTGAACAGAAAAACTGGGAAGACAGAAAAAATGACTTCT
GCCCGCTGGATCTGGGCTTGTTTCAGGCTCTGGAGAGAGA
GAGGGTCCTGGAGGTCCTTCAGAGAGACAAAGCACTACGA
ACTATCGATGCAGACAGAGTCAGGAGGCTCAGAGTAGAAC
TTCACGGACTCTGTCTGCAGACTTCGAGGATCATTTCACG
TCCGTTCGGTCAGCGGTCGTGTGCTCGGTGTCAGCGAGTG
CTGGGGAAGTTCTGGGACTGTGGTTCGGTGTGCTGTGGAT
GCAGTCACCGCATCTGCAACCGCTGTCAGGTTGTCCGCTC
TGCACACGACTGGAAGTGCACGGTGTGTCACGCATACAGG
GAATTTAAGATAAAATCTGGGGAATGGTTTCTGGAACAGC
AAGCAAAGAAATTTCCAAGTGTCAAAGAAAACAGCGAAAC
CACAGGAGACAAGATGTTACAGTCTTATCAGCGGCTCAGC
TTCATTGCAGTTGTGCCTCCAACTCCTCCTCCATTTTACA
ACCCGCCATCATTTAACAGACTGGAGGAACACAAAAAGCC
TTTCACCAAGTCGATGGAGAACCTGGTGGCATCAGTCAGT
GCTCACATTAAAAAACTGTCCAAATCTCAGAATGACTTGA
GTGAAGTGGCAGGTCAGCTGACAGTGGATCACGGGCACAT
GATGTACTCACGGCGCAAGAGTCTGTCAGATGGAGCCATC
AACAGAGCTCTGTGCAAAGTTCCGAGTTTACCCATTCTGT
CCACGGCGCAGTCCACTTCAACAAGCACACTTTGCTTGAC
AGATGATGATGTTTCATCCACATCCGCATACAGCGATGAT
CAGCGGGACAGCAACAGCAGCACTGGGATGGATTCTGTGC
TGTTTGAAAACACTATTAGTGTGACTGGAGAAATCGAGGT
GGTTTTGGCCTACAACAACAGGACGTCCTGTTTGGAGATT
ACGATCAAAGCCTGCAGAAATTTGATGTTCAGAGATACGA
AGAAGAAATGCCATCCGTATGTGAATGTCTGTTTGCTTCC
TAAGAAATGTCACAATTTTAAGATGAAGACAGCAGTGAGG
AAAGGGAAAAACCCGGTTTACAACGAAACCTTTACGTGTG
TACTTTCTGCTGATCTGCTGTCCAGCGCTGTGCTCCAGCT
CTCCGTCTGGCACAGTCGAGGACTCAAGAGGAGACTGTTT
CTGGGAGAGACGCTCATCCGGCTGGCAGACATGGATCTGG
AGGACACTGACTCTCAGCGTTCGCTCTGCTGCAAACTTAA
TCCAAAGGCTCCTCAACTGGGTGGAGACGCAGAGCTGCAG
TTTACCTCAGTGCTGCTGCTGATCCAGGCTCAGTTCCACA
CTCTGCCGCACAACAACACACAGACACACGGTGTTTTATT
AGGAGCTCCAGGCCAGCTCACAGTTCTCTTTACAGATGTG
TCCAAGCTGCTTTCCGTATCTAAAACTGCTCACTTCGAGG
GGATCCTTTGCCTTCCAGGACACAGAGAGCTGGTACGGAA
AACTTCAGCATTGAAGAAAACTGATGGCAGTATCCGAATG
AGCTTCAGCAGTCTGAGCCAACAGGAGCTCCAGCAGGCCA
CACTCACACTCAACCTGTGGGAGAAAAACTGCTTACTTAC
ATCAGCACGACTGCACAAAGAGTCCTCTTGGCAGCATCTC
CAGCGGATGCCGGGAGTTTGGCAGGAATTCAATCTTCAGC
TACAAGTAGTGCAAACATGAGGTCATGACGAAGAAGACTG
AGATCCTTCCCATCAACCCACAGACCCCGACACAGACTGC
ATTCCAGTTTTTATTCATACTCTTGACTTGCTAACTTCCC
TAAGTCCCGTTCCCTCCAATGTCCGCCATTGATTACATCA
CACAAGTGTCATTGCTAGCAGAACATCTGAATGGGTTTAA
ATGGAATGCCCAAAACCCTTGAGCACTTAGGAACTACACA
CTTATGACATTACAATTGCATTGTATAAGTAAGGGATGTC
CAGACTTGGTCCTGGAGGGCCGGTGTCCAGCAAAGTTTAT
TTCCAACCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations