Transcript

siae-201

ID
ZDB-TSCRIPT-090929-3960
Name
siae-201
Previous Names
  • siae-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000017947 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017947|OTTDARG00000014991|ZDB-GENE-040426-1032 siae|OTTDARP00000015160 DKEY-7L12.3-001 LG_ BX927074.16 Danio rerio protein_coding KNOWN, 2275 bp
ATTTGACACACTTCCTTGTTTTGAATAACTTGCAGTCATG
TTGACACCGGTGTTTTCCTCGCTGGTTTTGAGCGCATTTG
CCACTGTTTTATCGGCAGGGGAGGTGTTTAGATTCTCTTC
TTATTATGGGAGTTACATGATTCTGCAAAAAGCCCCAGCC
AAGTCAGTCGTGTGGGGATTTGGACAGACAGGAGCCAAGG
TTGTGGTGTCCCTGTCTGGGTCACACCTTCTGGAACAAAC
ATATATCGCTCCTGTTATCAATGGTATTTGGCGCACAACT
CTCAAACCCATGGAGGCTGGTGGTCCCTACACACTGACTG
CATATCATAGCACAACTAATAGCTCCATTGTACTTAAAGA
TGTGCTCTTTGGAGACATCTGGTTATGTAGTGGACAAAGT
AACATGGCATTCACTGTTGGTCAGGTGATTAATGCAACAG
AGGAACTAACAATGGCCTCTAAGTTCCCAGATGTGAGGAT
TTTCCAGGCTGCCTTGGAGCAAAGCAAAAAAGAACTAACT
GATCTCGCAGGAGTGGAAGTTCCTTGGTCCAAACCAACAC
CAGGCTTGCTTGGTGGAAAGGATTTCAGCCATTTCTCTGC
AGTTTGCTGGCTCTTTGGCCGCTACCTCTATGAGAAACGG
AAGTATCCCATTGGCCTGGTACATTCCAGTTGGGGAGGAA
CACCTGTGGAGGCCTGGTCTTCCCCGAGGGCACTTCAGAA
GTGTGGGTTGAAGAGCTCAGTTATCAGTGAGCAAAATACC
TGGAGCAGTTCAGTGCTGTGGAATGCCATGATCCATCCAT
TACTCAACATGACGATAACCGGAGCCATATGGTACCAAGG
TGAGGCTAATGCAAACTACAACAGGGATAAATACAACTGC
ACTTTCCCTGGCATGATTGATGACTGGAGAATGGCTTTCC
ATGAAGGCTCTGAAGGCCAGACTGCACTAGACTTCCCATT
TGGATTTGTTCAGCTATGCACATATAAGACAAAAGATCCA
ACGGATGGCTTTAGAGAGATACGCTGGCATCAGACAGCAG
ACTATGGCTTTGTCCCTAATAAGCGGATGAAGAACACCTT
TATGGCTGTTGCTGTTGATGTACCTGATGAAAAGTCCCCA
TGGGGCAGTATTCATCCAGAGGATAAACAGGATGTGGCCT
TCAGACTTGTGCTTGGAGCAAGAGCTGTCGCCTATGGGGA
GAAGAATGTGACTTTCCAAGGACCTTTCCCTACTCAAGCC
GTGCTCGGCAACAGTTACATAACCATTGTGTTTAATCAGG
ATATCAAGGCCAGTCATGAAGATGGTTACTTTGAGATCTG
CTGCTCTGAGGATAGGAAATGTGAAACAGACGACAAATGG
ACACCTGTTGCCATTTCAAGCAGTGGATTGAATTACATCT
TTTTGGAAATACCACCATGTCCTGCTTCTATTACTGCTGT
CCGCTATCTCTGGACAGACTGGCCCTGTAAATTTAAAGCT
TGCCCCATCTACAGCTATGATGGACTCTTGCCTGCACCAC
CATTCATCCTGGGCGTAACAAACCAGAGACCAACAACAGT
ATTCTAATCTAGTTTATGAAACCTAAATCTGCACATTTTG
TTTCTGTTCTGTATGATGACCTGGTGATCTGAATCTAAAT
GATAAATAAGTGAGACGTACTAACTGAGCAGTTCTTAAGT
GAGCATTGTCCCTGTGACTATATTTAAAGCTACCATCATA
TAGGTTTTGCTAATTGTGCATATTTACAAAGAGCTTTTGA
ATGAATGCATTTCTGCACAACTTTTTGAGGGACATAACCT
GAAAATATGAAATGAATGTAACTTAAAGGGATAGTTCTCT
CAAATTGAAAATATTTTCACTATTTACTCATTCTCAAATG
GTTATAAACCTTTATGAGTTTCTTCTATTGGATACTAAAG
CAGACATTTTGAAGAAAGCTGAAAACCTGTAATCATTGAA
ATACATAGCAGGAAAACAAATATGGAAGTCTGTGGTTATG
TTTTCAACAATTCTTAAGATATCTTCCTTCGTGTTTAAAA
GAAAGAAACTCAGACAAGTTTGGAACAAGTGAACGCTGAA
TAAATGATGGCAGAATTTTCATGTTTGGGTGAACTAGTCC
TTTAGCTGAAGTCTACCGCAGTATTTCTACTGAGTTCAGT
AGTTTGCACTTTATGATTATGATTTAGGTACCACACATTG
GTATAAAAACAATCTGTGTAAAAAATCAGTATTCATTTTA
TGTGAAATAATATTAAACATTTTGTGTTGAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations