Transcript

styk1a-202

ID
ZDB-TSCRIPT-090929-3893
Name
styk1a-202
Previous Names
  • si:dkey-14o18.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017747 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017747|OTTDARG00000014842|ZDB-GENE-060503-428 si:dkey-14o18.6|OTTDARP00000015005 DKEY-14O18.6-001 LG_ BX927218.17 Danio rerio protein_coding KNOWN, 1677 bp
CACACAGACAGTGAGTCTAAGAGCACTTAAACAACACTCA
GAGTTGAAACAAAGCTGATGATACGTTGGGAATGAAATAC
AAAAACAAAGACCAGCAAATAGCAACAAAACACTTCTACA
AGTGTGGAAAATGAGAAGAAGTTCCAGCTTTACTCATTAT
GTCTAATTTAACCAACACAACGTTTGCATGTATACCGGGC
AGTCTTTGTGAGGTGCTTTTTTATCAAGTCGAACTGATCG
TCGTTCCAGTTCTGTTCCTCTTGCTTTTTCTTGCCATAAT
GATCATCTTGCTGGTGCTCAAATGCTCCCATAAGAAATCG
TATCGTCACAAACACCACAGAAAGGAAAACGACCACACGC
AACACCATCATAACACACAGGGATCGCATAGAAGCAACAG
ACGACACCTGCAAGGCATTGACGCTCCAGCAGAGCTGAAC
CCGATGGAACATGAGGTTATTCCCATGACAGCACAAGCTC
CACATGAAGTGCAGAGTTCAGCTTCTGCAATCCCTCAACA
GACCACAGAGAGGCATCCGAGCTCCTTCCAGCTGCTCTCT
CCACTGCCCATCAGCTTCTCAGTGAAACAAGACAACTTCA
CGCTGCACAGAGCTGCCATCGATAGACAGCCAGTCATTTT
ACGAGTGCTTAAAGAATCGGCCAATGCCAGAGAGCGCCAG
TCTTTCCTGGGGTTTTCCCACTTTCTGTCAGAGCTGGGTC
CACATGAATCACTGCCCAAACTGCTGGGTGTGGTGAGTGC
ACGGACACCATTAATGATGGCGGTGGAGGAGCTGGAGCAC
AGAGACCTGCTGGGCTTCCTGTGGAGGTGCAGACAGGCAG
CGCCATGTGACATGACTGAGAGACGAATCTTTACCATGGG
TGCTCAGATCGCATCTGCCCTGGAGTATCTGCATAGTAAG
AACTGCATTCATGGGAACGTCAAAGCTCGAAGTGTCCTGG
TTGGTCAGGATCTCTCAGTCAAGCTGTGGGGTTTGGGTCC
AGCATATCACAGAAAATCAAATGCGAGCTCTATAGAGGAT
CTAGAAGAAATAGAAACGAGAAAATGGCAAGCTCCGGAAT
TGCTGGCACGACAGCCTCTGCAGCAAAGCAGCGACGTATG
GTCCTTTGGCATTTTGCTCTATGAGATGGTGACATTAGGA
GAGGCTCCCTTTCCCAACATCATGGCCAGTGAACTTCTGC
AACATTTACAGAGAGAAAACACCCTGAAGAGGCCACCAAA
CTGCTCCAATACACTATATTCTATCATGAAGTCCTGCTGC
AAGTGGAGAGCAAAGGACCGTGTCTCATTGGCAGAGCTGA
TCCGAAAGCTCCAATCAGGAGAGAGAAGCGCAAATGATCA
GGCAGTGCTGCGAGTGTCGGAGCCGCTGGACATAGAGAAA
TACATGCAAGAGGCGGGATATGGAGAATCACTCAATTATG
CTGTGCTCTAATGATGACTTAAAGGTGTAGCTTACTCAAA
AATGAAAATTCTGTCATCATTTACTCACCATTGACTTGTT
CCAAGCCAGTATGTGGAATACAAAATAAGATTTTTAAATA
TGTTGAATTCCATATTATTTGTTTTTCCTACATGAATGTC
AGGGATTGCAGCCCACCAAGCATTTTTTTTTGTTTTTAAA
CGATATCTAATAGATGTCTTATAGACGTCTAAACATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations