ZFIN ID: ZDB-TSCRIPT-090929-3876
Transcript Name: megf11-202
Previous Name: megf11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017701 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017701|OTTDARG00000014799|ZDB-GENE-060503-252 megf11|OTTDARP00000014965 DKEY-242H9.1-001 LG_none BX908395.15,BX890618.14,CR788229.7 Danio rerio protein_coding NOVEL, 2976 bp
ATGGGGCCGGTACGGGCCTACCCATTAGCCCTGCCTGTGC
TGGCTGTTCTGGGCCTCATTATCAGCGCATGGAGCCTCAA
CCCTGATGACCCCAATGTCTGCAGTCACTGGGAGAGCTAT
GCAGTGACTGTTCAGGAGTCTTACGCTCATCCTTTTGACC
AGATCTACTATACCAGATGCACCGACATCCTCAACTGGTT
CAAATGCACCAGACACAGGACCAGCTACAAGACCGCATAT
CGGCGCGGGGTGAGGACAATGTACCGTCGACGTTCACAGT
GCTGTCCTGGCTACTTCGAGAGCGGGGACTTGTGTGTCCC
TCGATGTAGCGAGGAGTGTGCCCATGGTCGTTGTGTGTCT
CCTGATACGTGTCAGTGTGAGCCAGGCTGGGGAGGACTGG
ACTGCTCTAGTGGTTGTGAAAGTGGCTACTGGGGCCCCCA
TTGCAGCAACCGTTGTCAGTGCAAGAATGGGGCCCTGTGT
AACCCCATCACAGGGGCCTGTGTCTGCACAGACGGCTACC
AAGGCTGGCGCTGTGAGGATCTGTGTGAGCCCGGCTACTA
TGGCAAGGGCTGCCAGCTGCAGTGTCAATGCCTCAACGGT
GCCACCTGCCACCACGAGACGGGGGAATGCATATGCGCAC
CAGGCTACATGGGCCCCATCTGTGGAGAGCGCTGTCCCTC
TGGAAGTCACGGGCCACAGTGTGAGCAGCGATGCCCCTGT
CAGAACGGAGGAACCTGCCATCACATCACTGGGGAGTGTT
CCTGCCCGGCTGGATGGACGGGTTCTGTGTGTGCCCAGCC
ATGTCCGTTTGGAAAATATGGGATCAACTGCAGCAAGGAA
TGCTCATGCCGCAATGGAGGACTCTGTGACCACATCACAG
GACAGTGTCAGTGCATGGCGGGATACAGCGGCCACAGGTG
CCAGGAAGAGTGTCCGGTTGGCACCTATGGACCCCAGTGC
ACCCTCCATTGTGACTGTCAGAATGGGGCAAAGTGTTACC
ACATCAATGGAGCTTGTTTGTGCGATACGGGATTCAAAGG
GCACCACTGCCAGGATAGATTCTGTCCACCAGGCCTTTAC
GGTCTCATCTGTGACAAATACTGCCCCTGTAATTCCACCA
ACACAATCAGCTGTCACCCCTTGACTGGTGAATGCTCATG
TACGGCGGGATGGACGGGCCTATATTGTAACGAGACCTGT
CCCCCGGGCTACTATGGAGAAGGATGTGGAGTGCCGTGCC
AGTGTGCTAATGGAGCCGACTGCCACAGTCTCACCGGGGC
CTGTATCTGTGCCCCGGGCTACACAGGAGATGACTGTTCC
CAAACCTGCCCATCTGGACTATTTGGGACTAACTGCACTT
CCATTTGCCACTGCCACAACCAGGCGTCCTGCTCACCAAT
CGATGGCTCCTGTATCTGTAAAGAAGGTTGGCAGGGTGTG
GACTGTTCAATCCTGTGCTCCAGCGGGACCTGGGGTTTGG
GCTGTAACCAGACTTGTTTGTGTGCCAATGGTGCGGCTTG
TGACCCAATCGATGGCTCTTGTACCTGTTCCTCAGGATGG
AGAGGGGAGCGCTGCCAGCAGCCGTGCCCCGATGGCACAT
ATGAGTTGGAGTGTCGCGAGCGTTGTGACTGTAACCACGC
TGATGGATGTGACCATGTGAGTGGATTATGTCGCTGTCTG
CCAGGATGGACAGGCATCCACTGTGACAGCATCTGCCCGC
AAGGCTTCTGGGGGTCCAACTGCTCCATGACCTGCTCATG
CCAGAACGGAGGTTCCTGCTCTCCTGAAGATGGGACCTGT
GTTTGCGCTCCTGGCTACCGAGGGACGTCCTGCAAGAGAA
TTTGTCCTCCAGGTTTCTATGGGCACCGCTGCAGTCAGTT
ATGCCCACAATGTGTGCACAGCACTGGGCCTTGTCACCAC
GTCACGGGTCACTGTGAGTGCCTGGCCGGCTTCTTCGGCT
CGCTCTGCAACCAAGGCAATGGAAAATTTGGGAAAGCCTG
CGCTGAGATCTGTCTGTGCACTAACAATGGAACCTGCAAT
CCTATTGATGGCTCTTGCCAATGCTTCCCAGGCTGGACCG
GAGACGACTGCTCACAGAGCTGTCCCTCAGGGTTTTATGG
GCGAGACTGTGCAGAGGTGTGCCGCTGTCAAAATGGAGCT
GACTGTGATCATATCACTGGCCAGTGTGCCTGTCGGACTG
GCTTTATTGGGACCAACTGTGAACAGAAGTGTCCTCCCGG
GACATTTGGCTATGGCTGTCAGCAGCTGTGTGAATGTATG
AACAACGCCACCTGCGACTATGTGACTGGAACCTGCTACT
GCAGCCCGGGATACAAAGGCATCCGCTGTGACCAGGCGGC
TCTAGTGATGGAGGAACTCAACCCGTACACTAAGATCAGC
CCCGCTCTGGGTTCAGAACGCCAGTCCGCAGGCGCCGTCA
TGGGCATCATCTTCCTGCTCCTGATCATCATGGCCATGCT
CAGCTTGTTTGTTTGGTTCAGGCAGAGACAGAGAGACAAA
GGACAGGAAATGCCCAGTGTTTCGTACACCCCAGCTCTGC
GTGTCACCAACACTGACTACTCTCTTTCTGATTACATAAA
GGCCTCGATGTGTAGCTCCAGCTCGTGTTCCCTCAATAGT
GAGAACCCGTACGCCACCATCCGAGATCCTCCCAGCCTGG
CCTGCAAGCACACGGAGAGCAGTTATGTGGAGATGAAGTC
TCCCGCTCACAGAGACCTGACCTTCTGCTCCAGCACCAGC
ACAACCCTCACCACTGCCAGCAGGAACGTCTATGATGTTG
AGCCGACAGTGAGTGTTCTCCAGGGGCCCAACGGTCTGGC
CACCGGCTTCTCCCAGAGTCCCTACGACCTCCCTCGAAAC
AGCCACATCCCGAGCCACTACGACATCCTGCCCATGCGCC
ACAGTCCCACACACAGCCCACCGCCTCCAGAGAGCCCACC
CAGCTCCCTGCTGTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
megf11-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000017701 (1),  Ensembl_Trans:ENSDART00000147902 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)