Transcript

myo1g-201

ID
ZDB-TSCRIPT-090929-3816
Name
myo1g-201
Previous Names
  • si:dkeyp-92c9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017530 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017530|OTTDARG00000014669|ZDB-GENE-060503-562 si:dkeyp-92c9.3|OTTDARP00000014842 DKEYP-92C9.3-001 LG_none BX530091.6,BX927310.10 Danio rerio protein_coding NOVEL, 2997 bp
ATGGCGGAGCTGGAGGGCTTGGAGTTTGGAAAGTCAGACT
TTGTGCTTCTAGATGAAGTGACTATGGAGCAGTTTATGGA
GAATTTGAAGTTGAGGTTTGAGAAGAGTCGTATCTACACC
TTCATTGGAGAAGTAGTGGTGTCCGTTAACCCTTACAGAC
ATTTGGATATCTATGGGAAGGATGTCATTGAGGACTACAG
GGGAAGAGAACTGTATGAGAATCCACCTCACCTCTATGCT
GTTGCAGATGCAGCTTATAAAGCCATGAAAAGACGAGCCA
AAGACACATGCATTGTTATTTCAGGTGAAAGTGGAGCAGG
CAAGACCGAGGCAAGCAAATATATTATGCAATACATTGCA
GCGATCACCAACCCTAGCCAGAGGGCAGAGGTCGAGAGTG
TGAAGAACGTGCTCCTGAAGTCCAATTGTGTGTTAGAGGC
GTTTGGAAATGCAAAGACCAACCGCAATGATAACTCCAGT
CGTTTTGGGAAATACATGGACATCAACTTCAACTTTAATG
GAGATCCTACGGGAGGACACATCAACAATTACCTGCTGGA
GAAATCAAGAGTTGTTCAGCAGCAAGAAGGAGAAAGAAAC
TTCCATTCATTTTATCAGTTGTTACGAGGAGGGTCTGATG
ATTTGCTCAAGTCCTTATATCTACAGAGAGATCCTGCTGA
ATATACCTACACCAGTCAAGGAGCTTCTGTCACACTTGCA
TCCAATAATGACTCCCAATGTCATAAAGCTGTGATGGCAG
CATTAAAGGTGATTGGCTTTACTGCTGAAGAAATCAGCTC
CATCTACAAGACCCTCAGTACCATCCTACACCTGGGTAAC
CTTCAGTTTACGAGTGATGGCGAACATGTCGTGCTGGTTG
GAGAAGACATGCTGAAAAACATTTCTGAGTTGACGTCCAC
AGAGCCTGAGAACACAAGAAAAGCATTGCTGTATCGCACA
GTGGCTACTGGGGGTGGAGAGGTCATTGAAAAAGGACACA
GCGAGCAGGAAGCTAGCTATGGAAGAGACGCTTTTGCCAA
GGCTTTATATGAGAGGTTATTTGCATGGATTGTTGGTCGG
ATCAATGGCGTTATTGAAGTAAAAGACTACAATCCTGCCC
TCCACGGGAAGAACACTGTTATTGGTGTGCTGGACATTTA
TGGCTTTGAGATCTTTGACAATAACAGTTTTGAACAGTTT
TGCATTAACTACTGCAATGAAAAGCTACAGCAGCTCTTCA
TTGAGCTAATTCTGCGACAGGAGCAGGAGGAGTACCAGAG
AGAGGGAATCACGTGGCAACATATCGAATACTTTAACAAT
CAGATCATTGTGGATTTAGTGGAGCAGCCTCATAAGGGGA
TTATCTCTGTTCTGGATGAAGCCTGTCTCATTGCAGGGAA
AGTCACAGATACAGTTTGCCTGGACAGCATGAACAAAAAG
CTGGGCCAGCATCCTCACTACACCTCCCGGAAACTCTGTC
CCGCTGACAAGACTATGGAGTTCAATCGAGATTTTCGTAT
CCGACACTACGCTGGAGATGTAACGTACTCAGTTGATGGC
TTTCTTGATAAGAACAAGGACCCGCTTTTTCAAGATTTCA
AGCGACTGATGTACAACAGTTCTGACCCCGTTCTCAAAGA
AATGTGGCCTGATGGGAAAATGAGTATTACAGAGGTGACC
AAACGGCCTCTGACAGCCGCTACACTCTTCAAAAACTCTA
TTATTGCTCTAGTCGACAAACTGGCTTGTAAGGAGCCTTA
CTATGTGCGCTGTATAAAGCCGAATGAGGTGAAGTCTCCC
CTGCTGTTTGATGATGGACGCTGTCAGCACCAAGTGGCAT
ATCTGGGACTGCTGGAGAATGTCCGTGTGCGTCGAGCTGG
ATTTGCCTACCGACAGCCTTATGCACGCTTTCTGCAGAGG
TACAAGATGACCTGTGAGTACACGTGGCCTAATCACCTGA
TGAGCACTGATCAGGAGGCTGTGGAGGCCATAGTGAACCA
GCATGGCTTTGAGGATGATGTTGCGTACGGCCTCAACAAA
ATTTTCGTCAGGACCCCTCGCACACTCTTCACCCTGGAGC
AAGAGAGAGCCGCGCTCATCCCCATATTAGTGCTGTTCTT
ACAGAAGGTTTGGCGAGGTGCATTAGCACGTATGCGATGT
CGAAAAATAAGAGCAATTTATACTATAATGGGTTATTATA
AATGCTATAAAGTGAAGGCTCACTTCTGGGAAGTGGAGAG
ACGTTTTGCTAGCGTTCGAAACATGGCAGACTATGGGAAG
AGTGTGGAGTGGCCAACACCACCTGCAGCCCTGGCACAGT
TCCACAGAATTACACAACACCTGTACCGCCGATGGTGGGC
AAGGCAGCTGATCAAAAACATCCCCCCATCTGACATGGCT
GAGGTGAGGGCAAAAGTAGCTGCTTTTTCAGCTCTGAGCG
GGGAGAGAATGGACTGGGGCTACAGCCGTTCCTGGGAGAG
AGACTACTTGGCCAATGCTAAAGACTCTCCTCTGATGAGC
TCCAACTTTGTTCGCATCACTAAAGAGCTGAAGAACAAAG
ACCAGTATGGACAGGTCCTCTTCTCATCCGCTGTCAGGAT
GCTCAACTGGTTCAACAACACAAAGGACAGAGCTCTACTC
ATCACCGACAAACATATTTACAGACTGGAGCCCAAAAAAC
ACTTTAAAGTGCAGAAACGGATAGCGCTTGATTCGGTGGT
TGGTTTAAGCGTAACAAGTGGCAGCGACCAGTTGGTGGTG
CTACACACTGCCACTCAAGATGACTTTCTAGTGCACCTGC
AGAGGGGTCAACTAAATCCAAATCAAGATCGCGTAGGAGA
GTTGAGTACTCCTCTGCCAGTGAAAGTGTGCTCCACTGGA
CTCCAGGTACAAATGGGCGGCAAACCAAAAAGCATCACTG
TAGAGACCAAACCAGGACAGACAATCTCAGACTTCAAGAA
AAGTCGAACGGGATTTACCTTACTCCTGCCCCAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations