Transcript

pigc-201

ID
ZDB-TSCRIPT-090929-381
Name
pigc-201
Previous Names
  • pigc-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004877 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004877|OTTDARG00000004566|ZDB-GENE-030131-2714 pigc|OTTDARP00000004424 pigc-001 LG_ BX470128.8 Danio rerio protein_coding KNOWN, 1593 bp
GATGGCTTGACAGCTGCGGCTAAATACAGGAAACCCTGCT
CATTCGGCGATGGGAGCAGACAGCGGTCCAGGGGCTCCTT
CGGCCGTCCCGTGGAGGAAAGTGCTCTATGAACGGCAGCC
TTTCCCAGACAACTATGTGGACCGGCGTTTCCTGGAGGAG
CTGCGGCGGAACATCCGCGTCCGCCAGTACCGCTACTGGG
CTGTGGTTCGCGAGACAGGCCTTATCGCCCAGCAGGTGTC
CTGCGTGGCCCTCTTTCTCACACTGTGGTCCTACATGGAG
CAGGGTGAGCTGGAGCCGTCTGCCGTGTTATGCGTCTGCC
TAGGCTGCGCTCTGTTTGGATACGGGCTCTATGAGGTCCT
GGGAGGAGCCAGTGATGGCAAACGGACGCGTCTTGCGGAC
CTGCAGAGCGCTGCTGTCTTCCTAGCATTTACTTTTGGGT
TTTCACCAGTTTTAAAGACTCTGACCGAGTCGGTCAGCAC
TGATACCGTGTACGCCATGTCGGCAGTTATGCTCCTGGCT
CATCTGGTGTCTTTCCCGTATGCTCAGCCCAGTCCGCCGG
GAAGTCTTTCTCTAAATGCAGCTCTGTTCGGGTCGGTGTG
TCTAGCATCCCGTCTGCCCGGAGCCCTGCACACCTTCACC
ATGCTGACCTGCGCGCTGCTGGTGTTCGCGCTCTGGCCCT
GCCTGCTGCACCGGGTGCGGGAGAAGGCGGACTGGAGCTT
CCCCTGGGCGGCGCTGCTGGTGTGTTTGGCCGGCGTCAGG
GGTTTGGGAAGCCTTTGGCCCGAGGGAGCTCTTCTTCTCT
CAGTGGCTCTGTTAATGTTGACTCTACTCTGTCCACTGCT
GCTGGTTCATCTGCAGAGGCACAAGGACAACATTCACGGC
CCCTGGGATGAGGCTGAGATCAGAGAGGATCTGTCCCGCT
TCCTCAATTAAAACAGGGCTTCAAGACTTTGAGAGTCTTT
TCTTAAAAGGACGGATCGCTAAAAGTGAATATTAATTCAA
CATTTATTCGTTGTATGAGACTTTTTTTTCTTAATGTGGA
ACTTAAGAGAAGATATTTTGAGAAATGTTGAAGACTATAT
TTTTTAATTATCTACTAATGTATTACACTGAAGAAACTCA
TACAGGTTGGGAACAACATGAGGGAGAGTAAATGATGACA
GAAGTTTTATTTTTGGGTAAACTGTAACCTTTTAAGCACA
ATGTTTGTTGGGAATTGCCATTAAAAACTAAATAATACAT
ATGAGAATCTCATAAAAACATGCTCAGGTCATATTTCTCT
CTAAATTGGAAGAGAGCAAGCATAAAAAAATTCTAATCAT
TTTAAATTTTGGGATTAAGACTTTTTTACGATTAAACATC
CAATTGATCTTAAATAAATGAATTGATCTTTTTTTTCTTC
TACTTTTGTTGGCTTTATGATCTCAACATGGTTTATGATG
TTCCCCCAATTTTAAGAGTGTGGAGTTTTTCTTAACAGTA
TTTATATAACTGTGTAAATACTTCAGAATTTCTGGTGTTT
TTCTAAGATGTTTTTAAAAAATGCTGTTATTCTAACAAGC
TCAATGTATTGGAAATAAATGTTTTTAACCATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations