ZFIN ID: ZDB-TSCRIPT-090929-3809
Transcript Name: txnipa-201
Previous Names: txnip-001, txnipa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017513 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017513|OTTDARG00000014654|ZDB-GENE-030804-10 txnipa|OTTDARP00000014831 txnip-001 LG_ BX927224.10 Danio rerio protein_coding KNOWN, 2753 bp
CTCACTGGTAGAAGCGTCTGAGTATAAAACCCTAGCCTAG
CCCAGCGTGCACAAAGCTCCTATACAAACCATGCGAGCCT
GGAGTGTGTGATTAGTGCATTTGCATAAAGCACTTATTTA
CTGCTATTCACACATTTAATTCGTTTTGGATTGAGCTCGG
ATGCACTTCTGAAGGACTATTCAATATTTTAGCGATTTGC
CAACTTTTTGTTGCTGAGATCGAGACGTGTGTTTTCTTTT
TGGTTTGGAAATTTGTAACATCACAATGGTGGCGATGACA
AAAAGAGTGAAGGTCTTCGAGATCGCCTTCAATGATCCAT
CCAAGACATTTTACTGCAGTGGAGATAAAGTGGCTGGAAA
GGTTTTGGTGGAGGTGTCGGAGGTGACCAGAGTGATGGCC
ATGAAGGTCCTGGGAGTCGGTTGCGCTAAGGTGGAGTACG
CGAAAGGCAAGCAGAGATGCCGTGAAGAAGTGGACTATCT
GAAGTATGAAGATGTTGTCCAACTAGACGAACATCCAACA
GACAATGATGGTTCTGTCATTCTCCGCCCTGGCAACAAGT
ATGAATATTCATTTGGCTTTGAGCTGCCAGCCCAAGGGCA
GCTGGTGTCTTCTTACAAGGGCAAGTTTGGATTTGTTCAG
TACTACGTGAAGGCTCTGATGGAAAGACCCTGTCAGCCCG
CCCTGGAGTGCAAGAAACACTTTGAGGTTGAAGAGCCACT
GGATGTCAACACTCCAGACTTGCTGTCCCCAACTGGTGGC
ATGAAGGAGAAGAAGGTGACCTGCATGTTCATCCCTGACG
GCCAGGTTTCTCTCAACGCTAAGATTGACAGGCGTGGCTT
CTGTGAAGGTGAAGAGATCTGCATTGATGCCAAATTTGAG
AACACCTGCTCTCGCATCGTGGTACCCAAAGCAGCCATTG
TGGCCAAGCAGACCTACCAAGCCAATGGCCGCACCAAGGT
CTTCAGGCAAAAACTCTCCTCAGTGCGTGGCAACCACATC
ATCTCCGGCATGTGCGATGCCTGGCAGGGAAAGAGCATCC
GTGTGCCTAAAATCAAGCCTTCCATTTTGGGTTGCAACAT
CATTCGAGTGGAATATGCACTTATGATTTACATGCACATC
CCAGGCAGCGAAAAGTTGATTCTGGAGCTGCCCCTGGTCA
TTGGAACAGTGCCCTACAATGGTTTTGGTAGCCGCACCAA
CAGCATGAGCAGTCAGGATGGTTCCATCAGCAATGCATCG
AATAGCTGGGTGTCCCTGCGAATGCCATCATCCGCCCCAC
CAAGCTACTGTGACATTACACGCGATTGCTGCATAGACCA
ACCTCTTACTCCTCTGCTGGATGACTATGATGGTGGAGAC
AGTCCCATCTTCATGAATGCAGCCCAGTTCCAGTTCCCTC
CACTCCCTGCTTATTCTGAGGTGGAGGAGGAGTTCAATGC
AAACGCCCGCATGCTTCCTGTCTGCTGAACCAACCTTAGC
AGAGCACTAGAACTGAACTGTTGCCCGTAAAAAAGGGTAT
ATTTTCCCACTCAAAAGCTCTTCGGGCTTTCACCATGCGG
ATCAAAGTCTGTTTGAGAAGTGTCGTATGGATGTGTGAAA
GTAAAGATGAAGCGGAGGATTTCGGGGCCCCGAGTGGACC
TTCTGCAGGACGAGCTAGTCGAAGTTCAGAGGAAGAAGAC
GTGTAGTCTGAGCTCTCTTGTGCCTGCATTGCTGACAGCC
ATCTTATATCATGCATCACTCAAGTTAAATGTGTTTTTGT
CATATTACCGATGCTGTTTCAGGGCCTGAAAGAGGGCACA
AGGGCTGTTTGGTGTGCTGTATTTCATTATATTTGAGCTG
CTCTTTCTTACTATGAGATTACTGCTGAGGTGCAAACTGA
TTGTGTCGCAAAATAGCCATTTAAGCACACGTAGACTTTC
CCAAATGGTGGTCATGTACTTTCCAATAGTCCCCCAATAT
GACATCCATTAGCATTTAGTGCATCGTTTTCGTTATCATT
CCATAATTGTTTTGTGGGGATGGAAGATTTCATTTGTAGA
AACATTCTTCAACTTGTTTGTTTTTTGGTCATGAGGTTAG
GTTGGTGTTCTAACCAGAGAGATATATATATATTGAATGT
AAAGAAGATTTGTGGTATACCATACTCTTTTCATCAAGGG
AAAAATCATACAGTGTCAGTTTGTCTTTGAACAGTGTTGA
GGCTGTTTTTTTTTTTTTTCTTTTTATTTGAATGCACTTT
TTATGGATGCAAGTTGCTGTGTAACTACTCCCAGGGAGAT
TTCCTATGTTTTTCTTTTTGTCTTTCTTTTGTCTTCCAAA
ATTGTTTAGGGATCAGGCATTGCAATCCCAACTCAAGACT
GTACTGTAATGCACTCAAAACCTTGTCCTAAGAAAGGGCT
CCAGTGATGCTGTTTTTTCACTGTGGACTTGAGCATTAGG
CCAAAAAAAGAGAACTCAACACTCCAAGTGCCAAAATTGG
GGTCTGTTTGGACTTGAGCCCTGACCACGTTGATTTGTGA
GACCAGAAGCTGCACTGTGTGCAGTTAATCCTGAAGACAT
TTTGATCAACATTTCACTTGTGGAGATCTTCCTGAAATTT
GTTGATTGTGTGTGTGTGTTGTTTTGTTTCTTCACAGAGT
GAAATATTACTGTTATTATAAACAGTGCAAAATGTGCAAA
TATCCCTTTTTTGTATGTAATTTAAAGAGTTTTTGTATGA
GAATTCATTTTTAATAAAAGTTTTAAGATGTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
txnipa-201 Contained in:
OTHER txnipa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017513 (1)
  • Ensembl_Trans:ENSDART00000052421 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067376 (1) 2771bp
    GenBank:BC049493 (1) 2709bp
    GenBank:CA470871 (1) 901bp
    GenBank:CN020671 (1) 891bp
    GenBank:CO804446 (1) 844bp
    GenBank:BI889397 (1) 807bp
    GenBank:CK240298 (1) 590bp
    GenBank:BQ262316 (1) 568bp
    GenBank:AL913744 (1) 539bp
    GenBank:CO356539 (1) 515bp
    GenBank:AW233447 (1) 448bp
    GenBank:CD285440 (1) 441bp
    GenBank:CK676507 (1) 409bp
    CITATIONS (2)