ZFIN ID: ZDB-TSCRIPT-090929-3805
Transcript Name: lim2.4-202
Previous Name: lim2.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017505|OTTDARG00000014647|ZDB-GENE-040718-104 lim2.4|OTTDARP00000014823 lim2.4-001 LG_ CR384101.11 Danio rerio protein_coding KNOWN, 1021 bp
ACACAGCGAAAAGTCAGACACACACCAGGGCCCCTGCTCC
AACCAGTTCAAGTGTATTTGTTTCGGGGACAGAGGAGCTG
GCATTTAAAGGATTTTGCCACCATCAACAAAAAAGGCCAA
CAGTCCATTTCTCTTTTGCCTCTTAACCTCTCTCTCTGCC
CTCTCACTCCCTCTTTCCCCAGAGGATAAGCAAAGAGGGA
TTTGCCTCAGAAGCAACAAGTGTATATTTCCTTGCTGCAA
AGTCTCAGCGTGTGTCAGGATGTACAGCTTTATGGGCGGC
GGTCTGTTCTGTGCCATTGTGGGCAACATCCTCATAGTGG
TCTCCACGGCGACAGACTACTGGATGCAATATCGCCTGTC
AGGCAGCTATGCCCACCAGGGCCTGTGGAGGTACTGCATG
GCCAACAAGTGTTACATGCAGACAGCAAGCATAGCATACT
GGAATGCCACACGTGCGTTCATGATCTTATCAGGAATGGC
GTGTTTTGCGGGCATCATGGCAGGCATCCTCTCGTTTGCT
CACTTCTCTGCCTTTGAGAGATTCAGTCGTTCCTTCGCTG
CGGGAATCATGTTCTTCATCTCCACTTTCTTCGTGCTTCT
GGCCATGGCGATCTACACCGGAGTAACCTTAAGCTTCCTG
GGCAAGCGATTCGGAGACTGGCGCTTCTCCTGGTCCTACA
TACTGGGATGGGTGGCTATGCTCATGACCTTCTTTGCAGG
CATATTCTACATGTGTGCCCACAGAATGTATGAATCCAGG
AGAGTGGTGGGAAGTCGCTAATCTGAAGAAAGAAAAACTG
CGAGCAGCATAATTTAGCAGATACACGATGAATGCCTTAT
AACATTATGCCTTTAAAGCACTGCAAAAACACACTAGCAT
TTCAAAAATAGCATTAACATTTTTTTTTTTTACACAAGCA
AATATATTTGTATAATCCTGCACAGATAAATATACCAGTC
TTCACAGATGTCTATTTCACTTTTCATAATTTTTTTCAAT
AAAACTCTTCATCAAATCAAA

lim2.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lim2.4-201 (1)    Ensembl 981
lim2.4-202 1021
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lim2.4-202 Contained in:
[BAC] DKEY-211G8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000017505 (1),  Ensembl_Trans:ENSDART00000144923 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC076173 (1) 927 nt
GenBank:CO927285 (1) 900 nt
CITATIONS (2)