ZFIN ID: ZDB-TSCRIPT-090929-3802
Transcript Name: galr1a-201
Previous Names: galr1-001, galr1a-001, si:ch211-150o20.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017498 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017498|OTTDARG00000014641|ZDB-GENE-060503-290 galr1a|OTTDARP00000014816 galr1-001 LG_ BX572622.13 Danio rerio protein_coding KNOWN, 1805 bp
CTCAAAACGCACGAAGAGCACCTGCTGATGAAAACATGAA
TCTGTGAGCGCTGTCAGTACGAGAAATCAAAAGGATTATC
GATATCATCATAAACTTTAACAGGTTAACATGAAAAAAGT
ATGAAAAGAATATTAATTTTGTGATGCGCGTAAATGAGCA
CATTCTACTTAAACCCCGTTGCTGATGCTGCTGCTGCTGG
ACTCCAGTAAACTTTACAGGATTTTCAGCCTCCTCTGAAA
AATCAATAACCCAAGGAAATTAACTGCAGAAGACTTCCTT
TTCACGACGAAGCATCAAAATAAGCTCACGCTGAAGATGG
GCACCCAAAACAACAGTGATTTGGACAGACCTAGAAGCAA
CATAGACTTAGAAGCACCTGAAAAAAACCTATTTGGCATC
GGCACAGACAACTTAGTCACGCTTCTGATTTTCGGACTCA
TATTTACTCTTGGCGTCCTTGGAAACTCTCTGGTGATCAC
CGTTCTGGCTCAACGCAAACCCGGACAGCAACGAAGCACC
ACCAACATCTTCATCCTCAACCTCAGCGTGGCAGATCTGT
CCTACCTGCTCTTCTGCATCCCTTTTCAGTCCACAGTCTA
CATGTTGCCCACATGGATCTTGGGCGCCTTTATTTGCAAG
TTCATCCATTACTTTTTCACCGTGTCCATGCTCGTAAGCA
TCTTCACCTTATCAGCCATGTCGGTGGACAGGTACATCGC
CATAGTGCATTGCAGAAAGTCTTCGTCCATTCGAGTTGCG
AGGCATGCGCTGATCGGGGTGCTGGTCATATGGGTGCTCT
CTTTCGCCATGGCCACTCCGGTCGCCTACTATCAGGGCAT
CGTGGAAAGTGAGGACAACAGCACGTTTTGCTGGGAAGTG
TGGCCAGATCACGACAGGAGAAAAATCTATGTGGTCTGCA
CTTTTGTTTTTGGATATGTGCTGCCGCTGATTCTGATTTC
TTTCTGTTATGCCAAGGTCCTCAATCATTTACATAAAAAG
TTAAGAAACGTCTCCAAAAAGTCAGAGGCCTCAAAAAAGA
AGACAGCTCAGACTGTTCTGGTGGTGGTGGTGGTGTTCTG
CCTGTCCTGGCTGCCTCATCACGTGGTGCACCTGTGGGTT
GAGTTTGGCTCCTTTCCCCTGAACCAGGCATCATTTGTGC
TTCGCGTGGCGGCTCATTGTCTGGCTTACAGCAACTCGTC
TGTTAATCCAGTTATTTATGCGTTCCTATCAGAGAACTTC
AGGCAGGCCTATAAGCAGGTGTTTCGCTGTCAGGTGGCTT
CTGAGTGCCCTACAAATGAAGCCAGAGAAATGAAGAGCAA
GACAGAGGCAGCACCATCCACCAACTGCACCACTGTGTAA
TCCATATACACTATAATTCTCGATGGCTTTAAGTCTTCAG
TAGAAGGCAAAGGGGTAGTTCCATGTAAAATTATACTTTA
AATGATAAACATGGTTATGTTTTAATTGGTATGATCTTGA
AGGATTGGGCGGTTGACTTTTAAGGGCTTTTGTCATCATA
AAAAGAGCATTTGCTGTGTGCTTCAGTCTTGATGATGCAT
TTTCTCAGAGCGCAATCGAGACCTTACTTGGTACTTGCTG
TGAAGCTGTAGTGATGTATGGCCTGTAAATATGTGCAATC
AAAAAAAGTGTGGGAGTAAGAGTGAGTTTATGGGGTATGT
TTTTTTTTTTTTTTTTGCTTCAGGGAAAACAGGAAATATA
ATCAATCTTGAGCCATGTTATAATAGAAAAATGCTGTATT
ATTAAATTATAATTGGAACATTTTGTTTATATACGTTGTT
TTAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
galr1a-201 Contained in:
[BAC] CH211-150O20 (1)

Genome Resources: Vega_Trans:OTTDART00000017498 (1),  Ensembl_Trans:ENSDART00000138544 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)