Transcript

galr1a-201

ID
ZDB-TSCRIPT-090929-3802
Name
galr1a-201
Previous Names
  • galr1-001
  • galr1a-001
  • si:ch211-150o20.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017498 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017498|OTTDARG00000014641|ZDB-GENE-060503-290 galr1a|OTTDARP00000014816 galr1-001 LG_ BX572622.13 Danio rerio protein_coding KNOWN, 1805 bp
CTCAAAACGCACGAAGAGCACCTGCTGATGAAAACATGAA
TCTGTGAGCGCTGTCAGTACGAGAAATCAAAAGGATTATC
GATATCATCATAAACTTTAACAGGTTAACATGAAAAAAGT
ATGAAAAGAATATTAATTTTGTGATGCGCGTAAATGAGCA
CATTCTACTTAAACCCCGTTGCTGATGCTGCTGCTGCTGG
ACTCCAGTAAACTTTACAGGATTTTCAGCCTCCTCTGAAA
AATCAATAACCCAAGGAAATTAACTGCAGAAGACTTCCTT
TTCACGACGAAGCATCAAAATAAGCTCACGCTGAAGATGG
GCACCCAAAACAACAGTGATTTGGACAGACCTAGAAGCAA
CATAGACTTAGAAGCACCTGAAAAAAACCTATTTGGCATC
GGCACAGACAACTTAGTCACGCTTCTGATTTTCGGACTCA
TATTTACTCTTGGCGTCCTTGGAAACTCTCTGGTGATCAC
CGTTCTGGCTCAACGCAAACCCGGACAGCAACGAAGCACC
ACCAACATCTTCATCCTCAACCTCAGCGTGGCAGATCTGT
CCTACCTGCTCTTCTGCATCCCTTTTCAGTCCACAGTCTA
CATGTTGCCCACATGGATCTTGGGCGCCTTTATTTGCAAG
TTCATCCATTACTTTTTCACCGTGTCCATGCTCGTAAGCA
TCTTCACCTTATCAGCCATGTCGGTGGACAGGTACATCGC
CATAGTGCATTGCAGAAAGTCTTCGTCCATTCGAGTTGCG
AGGCATGCGCTGATCGGGGTGCTGGTCATATGGGTGCTCT
CTTTCGCCATGGCCACTCCGGTCGCCTACTATCAGGGCAT
CGTGGAAAGTGAGGACAACAGCACGTTTTGCTGGGAAGTG
TGGCCAGATCACGACAGGAGAAAAATCTATGTGGTCTGCA
CTTTTGTTTTTGGATATGTGCTGCCGCTGATTCTGATTTC
TTTCTGTTATGCCAAGGTCCTCAATCATTTACATAAAAAG
TTAAGAAACGTCTCCAAAAAGTCAGAGGCCTCAAAAAAGA
AGACAGCTCAGACTGTTCTGGTGGTGGTGGTGGTGTTCTG
CCTGTCCTGGCTGCCTCATCACGTGGTGCACCTGTGGGTT
GAGTTTGGCTCCTTTCCCCTGAACCAGGCATCATTTGTGC
TTCGCGTGGCGGCTCATTGTCTGGCTTACAGCAACTCGTC
TGTTAATCCAGTTATTTATGCGTTCCTATCAGAGAACTTC
AGGCAGGCCTATAAGCAGGTGTTTCGCTGTCAGGTGGCTT
CTGAGTGCCCTACAAATGAAGCCAGAGAAATGAAGAGCAA
GACAGAGGCAGCACCATCCACCAACTGCACCACTGTGTAA
TCCATATACACTATAATTCTCGATGGCTTTAAGTCTTCAG
TAGAAGGCAAAGGGGTAGTTCCATGTAAAATTATACTTTA
AATGATAAACATGGTTATGTTTTAATTGGTATGATCTTGA
AGGATTGGGCGGTTGACTTTTAAGGGCTTTTGTCATCATA
AAAAGAGCATTTGCTGTGTGCTTCAGTCTTGATGATGCAT
TTTCTCAGAGCGCAATCGAGACCTTACTTGGTACTTGCTG
TGAAGCTGTAGTGATGTATGGCCTGTAAATATGTGCAATC
AAAAAAAGTGTGGGAGTAAGAGTGAGTTTATGGGGTATGT
TTTTTTTTTTTTTTTTGCTTCAGGGAAAACAGGAAATATA
ATCAATCTTGAGCCATGTTATAATAGAAAAATGCTGTATT
ATTAAATTATAATTGGAACATTTTGTTTATATACGTTGTT
TTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations