Community Action Needed: Please respond to the NIH RFI
Transcript

nutf2l-201

ID
ZDB-TSCRIPT-090929-3719
Name
nutf2l-201
Previous Names
  • nutf2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017278 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017278|OTTDARG00000014463|ZDB-GENE-020416-1 nutf2l|OTTDARP00000014630 nutf2l-001 LG_ BX957344.6 Danio rerio protein_coding KNOWN, 833 bp
GATCAACATAAGAAACTGATTCGCTACACATTCTCTCCTA
AATGCTGATCTCAGATCTGTTTTATTACTGTGAGCGAGTT
CTGCGTCTTCTTGTTCCGGCGGCCAATAAGGCGCGAAGTA
ATCAAGCGGGGGAGCCTTTCCATTACGCCGAGGTCACTCG
TCGGCTACACGTGGAATTTCTGTCCTTTCAAACTTGAGCA
GGAGTTTCATAAGCTGAAAAACAATGGCAGAAAAACCGAT
ATGGGAGCAAATCGGCAGTGGATTTGTCCAGCATTATTAT
CATCAGTTTGATACAGACCGCGTGAAGCTCGCCGACTTGT
ATACTGACGCTTCCTGTTTGACGTGGGAGGGTGAAGGATT
TCAAGGGAAGAATGCCATCATGACCAAACTAAATAGCCTC
CCTTTTCAGACCATTCAACACAGCATCACAGCTCAGGATC
ATCATCCAACACCAGACAACTGCGTCATGAGTATGGTCAT
GGGCCAGCTCAAAGCTGATCAGGACCAAGTTATGGGCTTC
CAGCAAGTCTTCTTGTTGAAGAATTTGGATAACAAATGGG
TCTGCACCAATGACATGTTCCGATTAGCTCTTCATAATTT
TGGAGCATAATATGAAATATTATGTTCATGCAACTTTTGT
ATCTGGAGTGCGGGGTCATGGTTCACATTCCAAACTGTTT
TCATCCAATTTTTCCAAGGATCTTGAAGGTTTCTGATCAT
CTCCAGATAAGAAAAGGACATGTTAAAAACTGATTATAGT
AATCAAATTTTGTATGTTGTGGCATGCACTGGTTGACAAT
AACTTCAGTTTGGTAATAAATCTGTTCAACCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations