header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3635
Transcript Name: mllt11-201
Previous Names: mllt11-001, ottdart00000017101, si:ch211-210h11.4-001, zfinnucl0000002975

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017101 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017101|OTTDARG00000014325|ZDB-GENE-030131-3007 mllt11|OTTDARP00000014484 mllt11-001 LG_ FP085396.16 Danio rerio protein_coding KNOWN, 1330 bp
ATAGACGGGACACGCCCACGACTTATACACCTGCCGCTAG
TCCTCTTGACTCCTCAAATTTGCCACAGCAGGTGGGCGGG
GCGAATGCAAATCTCCCAGCACAGTCACTAGTGATGTTGG
GCGCGGTTGGTTCACATTAAGCAGCCGGCGAGAAGATTGA
CAACTAAACAGGGTGCACCGTCTAATCTTCATCAAATCTC
AATAATTACAGAACAGCTTGCATTCAAAAGAGAACCAACC
CGACCACATACATAGGCCTACTAGAGATCGAAATGTTGGA
CAAAACCAGCAGCCAGTTCGACTCCTTCCTGTTCTGGAGG
CAGCCAATCCCATCGCTGGACCTGTCGGAGCTGGAAGACC
TGGGCATTTCCGCACCCAAATCCAAGGAGATGAAGTCCAC
CAAGAGCTTCCCACGACAGGACGAGGACGAAGATCGGGAG
CTGTCCAAGTTCTCCACCTTCAACTTCTGGAAGGAGCCCA
TCCCCAGCATTGACACCTTGGATTTCAGCCTGCTGTTATA
AGACACTGCAATGCCATTATTATTTCAGGCCCAAAATCTG
TGTTTGAGGGGATAGCTCACACAAAAATTAAAAGCCTGTC
ATCATTTATTCACCTTCTACTTGTACTAAACCCGTACTAA
ACACAAAGGAAGGTCTACTGAAGAATGTTGAAGGAAAACA
GCCGTTGCTTTCAATAATATGTTTTTATTTACTTGTTTTT
ATTGATGTCAGGGGTTTAAAACATTCTTTATATTATCTAG
TTTTGTGTTCAACAGCAGAAAGGAATTCATAAAGGTTTAG
ATCTACTTGAGTGTGAGTGAATGGTGAGGAAATTTTCATT
TCTGGGGTGAACTATCCCTTTAACACCTCTGCAGTTTCAC
CAATTCTCTACTATCTACTATCTGGTATTGATGAATTGAT
TCGAAAAAATCATGTGTTATGCATTTCTTGTTAAACCATG
TCAGTACAATTGTGATGACTAAGTTCTCTGTAAGACAACT
GTCAGGGCATCATTGTATTTCACCGCCTTGTCAAGTCTAA
CTGCTCAATTGGTCATGCACATAAGGGTAAATTGGTGGAC
TTCATTTAATTTTTTAAGAAAAGGGTTGATTGAACGCTAA
TGTTTTACTGAAATGTTATTATTATTGTCTGCCCAATTGA
TTGTATAATGAACACATAGCATAATTTTGCTAGGTTAAAG
TGGAATCTCACTTTTAAGGTGTTTTGTATTGAGCGGAAAT
GCTAAAATGCTAATGCTAATGTTTCCCCCATTTTGTTTGA
CAAATGTCAGATGCCAACTAAAGTGAGCTTGCTGCTAAAT
CAACACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mllt11-201 Contained in:
OTHER mllt11-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017101 (1)
  • Ensembl_Trans:ENSDART00000104750 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124647 (1) 1253bp
    GenBank:BC142813 (1) 1219bp
    GenBank:CN504948 (1) 940bp
    GenBank:CK399137 (1) 861bp
    GenBank:CK706723 (1) 840bp
    GenBank:CK361354 (1) 827bp
    GenBank:CK680057 (1) 436bp
    CITATIONS (2)