header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3578
Transcript Name: krt1-19d-201
Previous Name: krt1-19d-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016891 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016891|OTTDARG00000014152|ZDB-GENE-060316-1 krt1-19d|OTTDARP00000014317 krt1-19d-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1371 bp
ACAGCATCACCTCCATCAGCATGGCCTCCAGCTACTCCAC
CCGAAGCTACATGTCCTCCGGCAGCTCCATCCGCATGTCG
AGCAGCAGCAGCAGCAGTCAGCGGGTCAGCAGCATGCGGG
CCGGCAGTGTTTATGGCGGTGCTGGAGGATCAGACGTCCG
CATCTCCAGAGCCACTCATTCTGCTGGAGGCTTCAGCATG
TCTGGATCTGCAGACAACAGCAGCATCATCGGCAATGAGA
AGATCACCATGCAGAGCCTCAATGACCGTCTGGCCACTTA
CCTGGCTAAGGTGCGCGCACTAGAGAAGGCCAATGCAGAG
CTGGAGCTGAAGATCCGTCAGTTTCTAGATGGCAAAGCCT
CCCCGAAGACTCGCGACTATAGCGCGTACTATGTCACCAT
TGAGGATCTGCAGACCAAGATCATGGCAGCCATTCATCTG
AAGGGTGGACTCCATCTCAGCATCGACAACACCAGTCTGG
CCATGAATGATTTTAAAACAAAATTTGAAATGGAGCACGT
CATGCGTCAGTCTGTGGAAGCGGACATTGTGGGCCTGAAG
AGGGTGCTGGATGAGCTCAACATGTCCAGAAAGGACATCA
CCATGCAGATTGAAGGCCTGAAGGAGGAGCTGGTGTTCTT
GAAGAAGAACCATGAGGAGGATCTCTTGGCTGCGCGCGCA
CAAATGAGCGGACAGGTCCACGTCGAAGTAGACGCCGCTC
CACACCAAGATCTCACAAAAATCCTGGCAGAAATCCGTGA
ACATTACGAAGCAGTCACAGCGAAGAACCAAAGAGAACTG
GAGCAGTGGTTCAAGACAAAGTCAGAGTCTCTGAAACAAG
AAGTCGTCACCAGCACCACAGACCTGAAAACATCTCGCTC
TGAAATCAACGCGGTCAAATCCAGACTGCAGGCGTTGGAA
ATCGAACTCCAGTCCCTCCTAGCCTTGAAAGCATCGTTGG
AGACCACGCTGTCCGACACGAAGAATCGATACTCGATGAA
GCTCTCTGGCTACCAGCATCAGGTCACTGTCCTGGAGGAG
CAGATAGTGCAGCTCCGAGCTGATCTGGAGCGCCAACGTC
ATGATTATCAGATGCTTCTGGACATCAAGGCCAGACTGGA
GATGGAGATCGCAGAGTACAGGAGACTGCTGGATGGAGAA
GCCACTGTCAAAACAACCTCCAGTTCCACCTCGAGAACAA
AAGTCATCACAGTCGTGGAAGAGGTTGTAGATGGAAAAGT
GGTTTCCACCTCCAGCTCTTCAACCATGTCTGACAGTCGC
AGATTGATCTGATATAATAATGCCTGTTTGTATTTGCAGT
ATATGCACAGAACTGGAAACCAAATAAAACAGCATTTACA
GTGTATTCTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt1-19d-201 Contained in:
[BAC] DKEYP-113D7 (1)

OTHER krt1-19d-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016891 (1)
  • Ensembl_Trans:ENSDART00000010373 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC097213 (1) 1429 bp
    GenBank:BC135068 (1) 1414 bp
    GenBank:CF347527 (1) 774 bp
    GenBank:CK024288 (1) 766 bp
    GenBank:BQ092519 (1) 614 bp
    GenBank:BE200731 (1) 598 bp
    GenBank:AI396842 (1) 558 bp
    GenBank:BQ260412 (1) 466 bp
    CITATIONS (2)