Transcript

si:ch211-81a5.1-201

ID
ZDB-TSCRIPT-090929-3564
Name
si:ch211-81a5.1-201
Previous Names
  • si:ch211-81a5.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000016860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016860|OTTDARG00000014135|ZDB-GENE-060503-608 si:ch211-81a5.1|OTTDARP00000014292 CH211-81A5.1-001 LG_none CU464180.12,CR626935.6 Danio rerio protein_coding NOVEL, 1226 bp
CCTTGACAGCAGCCCTCCGTCACGTCAGAGTTAATTCAGT
CGCTGCTTCTGAGTGAAGATGGCGGAGGCCGCTGCTGCTC
CACGACACCGGTTCTTCTGTCACTGCTGTAAAGGTGAAAT
AGACCCAAAGCTACCGGAATATGTATGTCCCAGATGTGAA
TCTGGCTTTATTGAAGAGGTGTCAGAAAACTTCAGTCTTC
TTCAGAATCGGGATGGTGCTGCTGGGACAGGCAGTGATGA
CATGACCTCACAGTTTGCTGAGCTGTGGCAGCTGCTCTTC
ATGGAGCATTCAGCCCTGCTCTCCGAGCCCTCGGTCACAG
ACGCGCTCCGCAGCTCCGGGCTCCAGCCAGCAGTTGCTGA
TCCTGCCTCTGGGACGGCGGGACCTGTGGCATCCGTCGAG
AGTCTGTCAGACTGCACCGAGCCTCAACAAAACAGCCCAC
AGACAAACTCCAGACAGGATCAGGGACAGGCTGTGGAGGG
GATTGTACAGCAGTTCCTGGCAGGTCTGTTTTCCAATTCA
GACAGTGCAGGTCCCCAAACCTCCTCATGGTCCAGCGCGC
TGCACTCAAACCCTGGAGACTATGCTTGGGGACAGGGAGG
TTTGGATGCGGTCGTAACACAGTTGCTTGGTCAGTCTGAA
AACAGCGGCCCCCCTCCTGCCGAGAAGGAGATGATCTCAT
CTCTGCCCACCGTTAGCATCTCCTCAGAGCAGGCTGCATG
CCGGCTGGAATGCCCCGTGTGTCGAGAGGAGTTTTCTGTT
GGGGAATCTGTCCGACAGCTGCCGTGTCTGCACTACTTTC
ACAGCAGCTGTATTGTGCCCTGGCTTCAACTGCACGACAC
CTGTCCTGTCTGTCGGAAGAGTCTGGATGGTGAAGACCGG
GGTTTTCAACCACGACCAGATCCTCAAGAAACAATCCCAT
CACCTCCAGATTTACCAGAACGAAGCACCTTCGAGACTCT
TTAGCCTCTTTCCTGCCTTTATCACTTTAATTATTCACCA
GTGCTTCATGAAGCCTCTACAAAGACCTCAGGTGCCTTCT
ATTTCATTTTAGTCCAGGCAGAAAACCAAATTTGAGATGT
CAAAAGCAACAACAAATGGTACTAATATACACTCACAGTG
TACTGCTATATGAAATCATGATCGTAATGTTTTTATCCTG
ATAAACAGTAGCTATGTTTCTATTCAAATATGCAAACTAG
ACTTATGAGCAAAACTCAACACAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations