Transcript

ch25hl1.2-201

ID
ZDB-TSCRIPT-090929-3525
Name
ch25hl1.2-201
Previous Names
  • ch25hl1.2-001
  • si:dkey-24l11.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016750 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016750|OTTDARG00000014059|ZDB-GENE-050419-90 ch25hl1.2|OTTDARP00000014194 DKEY-24L11.9-001 LG_ BX470164.10 Danio rerio protein_coding NOVEL, 833 bp
AAATGACACTAGCACACATTTTTCAGACAATTTGGGACTT
TGGGACGAAAGACTCTGTTTTGCAGCCTATTTGGGACTAC
GTGCGACTCAACCACTCAGAGACCCTCCGGTCTCCTCTCT
TTCCAGTGGTTCTTACCGTATCGTCATATTTTGTTCTTGT
CCTGCCGTACCTTTCTTGTGATATCTTGGGAAGGAAGTGG
CCAGCCATTTACCGCTACAAAATCCAACCTGACAAGCTGC
CAACAACTGCAATGCTCCTTCACTGCAGTGGAGTGACTCT
TTATAACCACATCCTTCTGGTGATTCCAGCAGCAGTCGCA
CAGTGGATGTGGAGACCTCCGATTCCCCTTCCCGAACAAG
CACCTACTTTACTAGAACTGGTTGGTGGAGTAACTGGAAA
CCTTCTTCTTTTTGACTTGCAGTATTTCATCTGGCACTTC
TTGCACCATAAGATTCGCTGGCTGTATGTGACTTTCCATG
CCATCCATCATAATTATTCTGCCCCCTTTGCTCTGGCCAC
ACAGTGCCTTGGAGGATGGGAGTTGGTGACGGTGGGCTTC
TGGACCACCCTCAATCCCGTCCTGCTGAGGTGTCATCTGC
TCACCACCTGGATGTTCATGGTGGTCCACGTGTACGTGTC
TGTGGAAGACCACTGTGGATACGATTTCCCTTGGTCCACA
TCTCGTCTGATCCCATTTGGTGTTTATGGAGGTCCGAGCA
AGCATGATGTGCACCATCAGAAGCCTAATACTAACTTTGC
ACCTCATTTTAGTCACTGGGATAAAATGTTTGGCACTCAT
GCTGATTTTAGATTTTCTAAACCTCGGGAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations