ZFIN ID: ZDB-TSCRIPT-090929-3525
Transcript Name: ch25hl1.2-201
Previous Names: ch25hl1.2-001, si:dkey-24l11.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016750 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016750|OTTDARG00000014059|ZDB-GENE-050419-90 ch25hl1.2|OTTDARP00000014194 DKEY-24L11.9-001 LG_ BX470164.10 Danio rerio protein_coding NOVEL, 833 bp
AAATGACACTAGCACACATTTTTCAGACAATTTGGGACTT
TGGGACGAAAGACTCTGTTTTGCAGCCTATTTGGGACTAC
GTGCGACTCAACCACTCAGAGACCCTCCGGTCTCCTCTCT
TTCCAGTGGTTCTTACCGTATCGTCATATTTTGTTCTTGT
CCTGCCGTACCTTTCTTGTGATATCTTGGGAAGGAAGTGG
CCAGCCATTTACCGCTACAAAATCCAACCTGACAAGCTGC
CAACAACTGCAATGCTCCTTCACTGCAGTGGAGTGACTCT
TTATAACCACATCCTTCTGGTGATTCCAGCAGCAGTCGCA
CAGTGGATGTGGAGACCTCCGATTCCCCTTCCCGAACAAG
CACCTACTTTACTAGAACTGGTTGGTGGAGTAACTGGAAA
CCTTCTTCTTTTTGACTTGCAGTATTTCATCTGGCACTTC
TTGCACCATAAGATTCGCTGGCTGTATGTGACTTTCCATG
CCATCCATCATAATTATTCTGCCCCCTTTGCTCTGGCCAC
ACAGTGCCTTGGAGGATGGGAGTTGGTGACGGTGGGCTTC
TGGACCACCCTCAATCCCGTCCTGCTGAGGTGTCATCTGC
TCACCACCTGGATGTTCATGGTGGTCCACGTGTACGTGTC
TGTGGAAGACCACTGTGGATACGATTTCCCTTGGTCCACA
TCTCGTCTGATCCCATTTGGTGTTTATGGAGGTCCGAGCA
AGCATGATGTGCACCATCAGAAGCCTAATACTAACTTTGC
ACCTCATTTTAGTCACTGGGATAAAATGTTTGGCACTCAT
GCTGATTTTAGATTTTCTAAACCTCGGGAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ch25hl1.2-201 Contained in:
[BAC] DKEY-24L11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000016750 (1),  Ensembl_Trans:ENSDART00000098347 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)