Transcript

ch25hl1.1-201

ID
ZDB-TSCRIPT-090929-3524
Name
ch25hl1.1-201
Previous Names
  • ch25hl1.1-001
  • si:dkey-24l11.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016749 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016749|OTTDARG00000014058|ZDB-GENE-030131-8617 ch25hl1.1|OTTDARP00000014193 DKEY-24L11.8-001 LG_ BX470164.10 Danio rerio protein_coding NOVEL, 1069 bp
AGAGGTCCAAGTCTGGTTCAGCAGTATAAATACGGCAGAT
TTGTTTCCCATTGGCATTCGCTCTCCAGCGTTGCTCAATC
CAGCAGCAGGATGTGGAACATCAGTGAAGTGGTTTTCCAG
CTCCCGACCTCCAGCGCCTCAGACCGCGTCCTCCAGCCCC
TGTGGGACTACCTGCTGCTCCGCCACTACACCCTCATCTC
CTCTCCGTTCTTCCCAGTACTGCTGGCCTTCTCCAGCTAC
ATCATCTTCAGTGTCCCCTTCGCCGTGCTGGATGTATTGG
GAGAGAAAGCTCCTCTGTTTAAGTATAAGATCCAAAAGGA
CCGGCGTCCCACTGTTGGAATGATGCTGAGGACTCTCTGG
ACGGCGGTCTACAACCATCTGGTCTTCGTTCTTCCAGCCG
TGTTGATCACCAACGTGGTAATGCCTATGCCTCCTCTTCC
CACCGTTGCGCCGACAGTATGGGAGATGTTTTCTGGCGGT
TTGGGAGCTTTGCTGGTCTTTGACACCCAGTACTTCCTCT
GGCACATGGTGCACCACAAAAACCCGCACTTATACAGGTG
GGTCCATGCCATCCATCACGATTACATCTCTCCGTTCTCC
TGGTCCACCCAGCACCTCAGCGGTGTAGAGCTCATGACGG
TAGGCTTCTGGAGCAACATCGACCCCATCCTGCTGAAGTG
CCATCCACTGACCGTCTGGACCCTCACCGTGTACAGCATC
TGGATGTCTGTGGAAGACCACATCGGCTATGACCTGCCTT
TTTCCCCTGGGCATCTGGTTCCATTCGGGCTTCTTGGAGG
AGCGATGGCACATGACATGCACCATCAGAAACCCAGCAGC
AACTTTGCACCTTTCTTCAGTCACTGGGACAAAATCTTCG
GCACTGCGATCACTGTGAAACTGACTCAGAAAAGCGAGAA
AGAGAAGCAGGTTGCTTGATCAGAAATCGGTTTAAATCTT
TAGTCTGTGTAAATATTTGTATAAAAGTTGTATTTTTGTA
TTTGGTGTTTCTACTGGTCTGTCTGCTTTATGTACGGGTG
AAATTATTAATAAACAACTGTTGTATATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations