Transcript

psmd8-002

ID
ZDB-TSCRIPT-090929-3509
Name
psmd8-002
Previous Names
  • zgc:86762-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016716 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016716|OTTDARG00000013576|ZDB-GENE-040625-136 psmd8|no_translation DKEY-224E22.7-002 LG_none BX908775.18,BX936429.8 Danio rerio protein_coding KNOWN, 921 bp
GTGTTGAAAGAGACTGCGGGATTATATGAAACATTGAAAG
CCGAGTGGAATAAAAAGAACCCAAACCTCAATAAATGCGG
TGAGCTCTTGAGCAAGTTAAAGATTTCCCTGTTGGAGTTG
AACTTTCTACCAACCACTGGGACCAAACTAACCAAACAGC
AGCTTATCCTCGCACGAGATGTTTTGGAGATTGGAGCGCT
GTGGAGCATTCTGAAGAAAGACATCCCCTCATTTGAACGC
TACATGGCTCAGCTTAAATGCTACTACTTTGATTACAAAA
CCGAGTGTCTGAATTTCACACAGAGCTGGAAAGACTGAGC
GCAAAGGACATCCAGACGAACGTCTACATCAGACACCCAG
TTTCATTAGAGCAGTATCTGATGGAGGGCAGTTACAACAA
GGTATTTCTTGCCAAAGGAAATATTCCCGCGGAGAGCTAC
ACCTTCTTTATTGATACTCTTCTTGATACCATCCGAGATG
AGATTGCAGGTTGTATAGAGAAAGCATATGAACAGATTCA
ATTCAATGAAGCCACGCGGGTGCTTTTCTTTTCCTCTCCA
AAAAAGATGACAGACTATGCAAAGAAAAGAAACTGGACCC
AGAGTCCTGATGGATACTACTCATTCAGCACCCAGCATCA
AAAGACAGAGGAGGTGACCATCCCCTCCACAGAACTGGCC
AAACAAGTCATCGAGTATGCAAGACAGCTGGAAATGATTG
TGTAGTGTGGATATTTGACACATGTATACATAAAGGTTCA
CATTTGTTCATCCAAACATACAAATAAAAGCATTGTACAG
TGGCCATATATCTGGACTCAGTTTAGACAGCGGATGACAC
ACCCACAAATAATGGATCTCAGAGGCCTACGAATGATCAA
TATCTGCCTGTATCAGGGTCTCTTGGTATGATTGTGTGTT
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations