Transcript

anpepa-201

ID
ZDB-TSCRIPT-090929-3421
Name
anpepa-201
Previous Names
  • anpepa-001
  • si:ch211-200o3.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016407 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016407|OTTDARG00000013785|ZDB-GENE-030131-4781 anpepa|OTTDARP00000013914 CH211-200O3.4-001 LG_ BX548061.6 Danio rerio protein_coding NOVEL, 3456 bp
ATGGCCAAATCAACTGGCATGTCCAAAGCCTTGGCTATTG
GCATTGGGGTGATCACAGTTTGTTCTGTTGGTTGTTTAGT
GGTGATGGCTGTTTTTTTCCAAATTCAGGTAGGCAACAAC
AAGCCAACGCCTCCACCAAGGCCAATATTACCTACGCCTC
TCCCAACAGATCTTCCAGAGTCTCTTAGACTTCCAGACAG
CTTGATTCCTGAGAGCTACAACGTTTTCCTACAACCGTAC
CTTTACGCGGCGATAACCAACAACTATACCGAACAATCTT
ACCTCTTCACCGGGAACTCAACTGTAAGGGTGAACTGTAC
GAAAACCTCCAGCAGGGTCTTTCTTCATGTTCACAATATT
AATGTGACGGCGGTGGAAGTGAGAAAATCGGATACCAATG
AGAAATTGCCATTGAAGGGATATCAAATTTTCAAGAACGA
AACTAATTTCCTTGACATCCATCTTGAGGTTGCGATAAAA
GAAAATGGGACCTATGATATTTTTACTGAATTTGAAGGGG
AGCTTCTTGAGGACTTGACTGGGTTTTATGCGAGCCGGTA
CACAGGGAAGGGAACTGATGACGAGGACGAAGAGAGATTC
CTCGCTACCAGCCTGTTGCAACCCACGGATGCCAGGACAG
TGTTCCCATGTTTTGATGAGCCGGCGATGAAGGCTGTATT
TACCATCACCATTATTCACAGACCAGAGATTAGAGCCCGG
TCCAATGAAGATGGAGATCCACGTACAATACAAATTAACG
GAACGGACTGGATTAGAACCACATTCAAGCCCACCAAAAA
AATGTCATCTTATCTCCTGGGCTTCATTATATATGATACA
CATACATTCTCATATGTATCTAAAGGAACCCGGACAAAAA
TACATGTACATGGTCGATCAGAGGCTATTGATGCTGGCCA
TGCTGACTACGCACTGGAAACAACTGAAACCATTCTAAGC
CACTATGAGAATATATTTGGACTTCGATACCCAATGTCAA
AAATAGATCAGATTGCCTTGCCAGACTTCGGTGTCAGAGC
AATGGAAAACTGGGGTTTCATTTCATATCAGGAGTCAGGA
CTGCTGTATGATAAAGAGACAGCCTCCACCTTTGATGAAG
AACAAGTAACTACACTGATCGCCCATGAATTGGCACATCA
GTGGTTTGGAAACCTGGTGACCATGAGCTGGTGGAATGAC
CTGTGGCTGAAAGAGGGATTCGCCACATACATGTCATACA
AAGGGGTGGAAGCTGTTGGCTGGGATTTAAAAGATCTAAT
CGTTCTCAGAGAAATCCAGACCGCCTTTCAAATGGACTCC
TTGAACACTTCCCATCCTCTCAGCATGAACGCATATGATG
TTCAGACTTCCTCTCAGATCAGCGAGCTTTTTGATGACAT
CACCTACAGCAAGGGTGCTGCTGTGTTGAGAATGCTGGCC
ACACGCATGGGGGAGAATGAATTTATGAAAGGAGTTAAGA
TGTATCTCTCCAAGTTCCAGTTTGAGAACACTGTGCCCAA
AGATCTTTGGGAATGCTTGAATATGGACACACATATTAAA
GTGGATGAGTTCATGAAAACATGGACCGAGGAAGTGGGTT
ACCCAGTACTCACCATTATTACTGACACCGGAGACACGTC
TCAGGAACAATTTTTACTAAAGAAAGAAGGCGGCCATGAC
TCTTTATGGCATATACCAATCAAATACATGACACTTAAGG
CGGGGGTGAAAGAGTTTCCCAATTTTTTTACAGATAAAGG
TCCAGATCCAATTCCAGATTTCAAAATTGGCAAAGATAAC
TGGCTTCTTGCCAACATCAACTGCACAGGCTTTTATCGTG
TGAACTACGATGAAGAAAACTGGAACAGGCTTACTGCACA
ACTTCAAAAAAATCATCGCATCATTCCACTCATTAACCGA
GGGCAACTCATTGATGACGCTTTCAATCTTGCAAGGGCTC
ATCGTCTCAACGTCACTATTGCGTTAAATCTAACCAAATA
CCTGATAAATGATTTGGAGTATATCCCATGGGAATCAGCA
CTGAAAAACCTGGACTTCTTTACCCTTATGTTTGATCGCT
CCGAGGTCTACGGTCCAATAATGAAATACCTACGAAACTT
GGTCACACCATTATATGAGGAATATGAGGAGTACACAATT
AACGGAACCATTCCAATAGAGAAGTACACTGACCAGTGTA
ACCAGGTAAATGCTATTACCGTGGCCTGCAGCAATGGACT
TCCTGAGTGCATAACAATGGCTAAAGATCTATTCAGTGAT
TATAAAAATGGCTCTAACCCGATTCATCCGAATTTGAGGA
GAGCAGTCTATTGCAGTGCCGTAGCTTCTGGCGATGAGGA
TGATTGGGAATATGTTTGGGAAGAATACCAAAAAGCCACG
GTCGCTGCCGAGAAAGACAAATTAAGATACGCACTGTCGT
GCACAAAAGAAATCTGGCTACTAAACAGATATCTGCAATA
CACTCTTGAGCCTTCAAAGATAAGAAAGATGGATATGGTG
TCCACCATAAGCTACATTGCCCAAAATGTCGCCGGACAGC
CTCTCGCATGGGATTTTATTCGTGGTCATTGGTCCTATAT
TACCCAAGAGTATGGAGCTGGAATCATATCCTTAGGTAGT
CTATTAGATGTTGTGACCAAAAGATTCTCCACAGAAGTCG
AACTCGAAGAGCTGAAGCAGCTTCAGAGGGAGCAGATACA
GGACGATAAGTGGATAGCAGCTCGAGCTTTGGAGCAGGTC
ATTGAAAGGACAGCGGCCAACATTATTTGGGTGAAAGAAA
ACAAGCAGGTTGTTAAGGACTGGTTCATTGCGGAGCTGTA
AATTATTCTTTTTTGTGAGTCTGCTAAATTGGAGTATATA
AAGCGGAGCCAAAACATTCACAAACAGATGTTAAGGCAAA
CCACAACAAAAGCAACACCCTCCTGTGATTCTGAGGTGAT
TTTGAACCACCGCAACTTTTGGAAGAGAAGAACAAAAAAT
GTCTGCATGACACTTTCCTTTTGGAACATGAAGTAGTTCA
TAACGAATATATGATGTATTCTTAAGAAAAAGGCCAAAAA
TGAGTCAAACCTCAAGGATCAATTAGATTTTTCTGTCTTA
TGATGTAGTTTTCTAATATAGATACTCCTGGTTCAGTATT
GTTTACAGTGATGAAATCACATGAGCACAAAACAAAAAAA
AACATAAGCACAATGCACTGTATTTTATGTTTTTATTTGT
ATATAGTTGAATCAGATGACATATTAACATCTATGAAAGC
ATGTTCTTTTAAAATATTAACTTTTTATTAAACAAAAAAA
AACTAAATTCTGTTGATCACTGTGATCTGTAATTATATTA
AAAAGTGAATAGCAAAGTTTGTGATGAGTTTTCATAAGAC
TGAATATTTTTAATACATTAAACATGTAATTATTTAAATA
AAGTGGCAATTTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations