Transcript

fam169b-201

ID
ZDB-TSCRIPT-090929-3419
Name
fam169b-201
Previous Names
  • fam169b-001
  • si:ch211-200o3.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016405 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016405|OTTDARG00000013783|ZDB-GENE-050419-217 fam169b|OTTDARP00000013912 CH211-200O3.2-001 LG_ BX548061.6 Danio rerio protein_coding NOVEL, 660 bp
GTGAAAGTAAGCAGTGAGAACATTGGTCAGCTCTTGTTTC
TGAATGATGGTGATTTATCACATTTTATTCTTGCTCTTCA
CACACCCGAGGATGAATCTCAAGTGGTTGCCATGTTCCTG
CAAGGCAAATGGTGGCCTGTTGGTGATGTTTTAAAGACGT
CAAACAAATCCAGATGTGGACTTTTGTTAGTGGAGTCTCT
GATGGAGAGAGTCGTGCTATTCCTGCTCAGCCAAGTTATA
TTTGGGATTCTGGAAAGGCCTCTTGAAGATGACCTATATT
TTTCTGCCTATTCTTTGAGGGAACATGGCAAAATCCTGTG
GCAAGATGGTGAAGCTGTTGGGTTTTATACTGTCAAGAAA
AAGGGCAGTCTGTGTAATGGCAGCACTGGCCAGAGTTATC
GGCTCCCTGTGTTGGATACTGTGTTTGTTCGCCCTCGCTG
GAGAAGGACTGGACTTGCTTTACAGATGCTGGAAGATTTC
TGCTCATCTCAGCCTTTTGAGTGCATTCTGGGAATTAGCT
TTCCTATGTCTCCTAGCATGTATGGAGTGTGCAAGAAGTA
TCTTGAGGTCCATGAAAAAGAAAGAGAGCGTCTCTATGAA
GTGGAAGCCCCTGGTGAATGGCCTCAGAGACGTAATGTGT
GGTTGAATATCCAGCTTCGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations