Transcript

kif23-201

ID
ZDB-TSCRIPT-090929-3380
Name
kif23-201
Previous Names
  • kif23-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016278 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016278|OTTDARG00000013677|ZDB-GENE-991019-4 kif23|OTTDARP00000013799 kif23-001 LG_ BX942814.11 Danio rerio protein_coding KNOWN, 3191 bp
AAAAATCTGTGTCTGATGCGGACGAGGGAACGTTTGAAAC
TTCGGATTTGTATACGGTCAACAAGAAGGTAACAGCGTCG
TGGAATTAAACTAAAACATCTCAGCATGATTAGGCAAGCG
AAGGGCAAGACCCCCCGCCGCCCTCCTCCAAAAAAACCTT
CAAACAACCAAAAGGACCCTGTTGGAGTGTATTGTCGAGT
TCGGCCACTGGGTGCTGAAGATGAGGAATGTTGCATTGAG
GTTATAAGTAACACCACCATTCAGTTACATGCTCCTGATG
GACTCAAAGCCAACAGGAATGGGGAATTCAAAGAGACACA
ATATTCCTTCAAAAAAGTGTTTGGAATTAAAACGACACAG
AGGGAATTATTTGAAGATGTTGCTAAACCTCTTGCCCAAG
ACCTCATTCATGGAAAAAATGGCCTGTTGTTTACCTATGG
CGTCACCGGCAGTGGTAAAACTCACACAATGACAGGCTCA
CCGGGTCAGGGTGGGTTGCTTCCACGCTCTCTCGACATGA
TCTTCAACAGCATCGGTCCTTACCAGGCCAAGAGATATGT
TTTCAAGCCTGATGATAAAAATGGCATGGAGGTGCAGAAT
CAGGTTGATGCACTGTTGGACCGACAGAAGCGAGACAGTC
AGACATCTGTACCAAAGACCCCAAACACAAGACGAGTTGA
CCCAGAGTTTGCTGACATGATCAGCCCAGAGGAGGCTTGT
AAGGCTGAAGGGGTGGATGAGGACAGCAGCTACAGTGTCT
TCGTTTCTTACATTGAGATTTACAACAACTACATCTATGA
CCTCCTAGAGGAGACCCCCTTTGACCCCATAAAGCCCAAA
CCACCCCAATCCAAAATACTGCGTGAAGATCAAAATCACA
ACATGTATGTGGCCGGGTGCACGGAGGTTGAGGTCAAGTC
AACAGAGGAAGCTTTTGAAGTCTTTTGGCGAGGTCAGAAG
AAGCGTAGGATTGCAAACACGCAATTGAACCGTGAGTCCA
GCCGCTCTCACAGTGTGTTCATTGTTAAATTGGCACAAGC
ACCACTGGATGCAGATGGAGACAATGTGCTTCAGGATAAG
AATCAGGTGAACGTGAGCCAGTTGTGTCTAGTGGATCTAG
CTGGTAGTGAACGCACTAGCAGAACCCGAGCAGAGGGCAA
CAGACTACGTGAAGCAGGCAACATTAATCAATCTTTAATG
ACTCTGCGCACGTGTATTGAGGTACTGCGGGAGAACCAGA
TGTGTGGCACCAACAAGATGGTTCCCTACAGAGACTCCAA
AGTGACCCATCTATTCAAAAACTACTTTGATGGAGAGGGC
AAAGTGAGAATGGTGGTGTGTGTAAATCCAAAAGCTGATG
ATTATGAGGAGACGCTGCTGGTGATGCGCTTTGCTGAGAT
GACTCAGGAGGTGGAAGTGGCCCGGCCTGTTGACAGACCT
ATCTGTGGCTTTGCTGCTGGTCGCCGACAGAGAAACCAGG
CCTTCAAAGAGGAGCTGACCCGCAGGCTAGAAGAGCGTGG
TGGTCCTGTAGATGGAGATTGTCCAACAGTATTAAATCAG
TTACTTCAGGCATTTCCTCCACTTCCTCCCTGTGAGATCT
CTGGCCCTAATGATGACGTCACTCTACCCAGACTCATTGA
GGCCTTGGAGAAGAGACACAAGATTCGACAGATGATGATT
GAGGAGTACAATAAAACTGCCACCATGCTGAAGTCTGTTC
TTCAAGAGCAGGACGGCAACATTCTCTCCAAGGAGAACGT
CATCCAAGAGCAGCGTGGCAAACTTGGAGAAAAAGACAAA
ATGCTCCAAAACCAGAAGAACGAGATTGATCGCCTGGAAA
AGAAATCCAAGATGCTGGAATACAAGATTGACATCCTGCA
GAAAACCACCAACATCTATGAGGAGGACAAGAGGTCTCTG
CAAAATGAACTGGAGAGCAGAGAACAGAGGCTACAAAGGG
AAATGTCTGAGAAAAGACGCATAGAGGCTCGCATGCAGGG
CATGGTCTCTGACACCAAGCTCAAGTGGGAGAAGGAGTGT
GAGAGGAGGGTAAACGCCAAGCAGCTGGAAATGCAGAATA
AGCTGTGGGTGAAGGATGAGAAACTCAAACAGCTCAAAGC
TATCGTGACCGAAGGGAAGACCGAGAACCGACAACCCCAG
CGGCCCTCCAGAGAAAAGGACAAAGTGCCCCCTAAGAGAT
CTGCTTCCCCGTCACCTGCTCCTACTGGGCCGCCGGTCCG
GCCTCTACACAGACGCTCGCACTCCGCAGGTGGGGAGAGG
TGGGTTGATCACAAACCTACCACTAACGTGGACCTGGATA
CAGTCATGCAACCAAACATCCCCAATGCCATCAAAGTGAA
CGCTCCCAACGAGAAAGCTCTGTCCAAGTGTGACAAGTAT
GTTCTGACACATCAGGAGGTGGCATCAGATGGAGAGATTC
AGACCAAGCTAATCAAGGGTGAAGTGTTCAAAACTAGAGG
TGGAGGACAGTCTGTTCAGTTCACGGATATTGAAACACTC
AAGCAGGAAACGCCTGTTGCGGCCAGCCGTAAGAGGCGCT
CATCAGAGTCTGGCCCAGACAGTGAGCCTATGGAAGGAAA
CTGGACTGATGTGGAGACCAGGTGCTCTGTGGCAGTGGAG
ATGAGAGCTGGCTCAAATCTTGGACCTGGATACCAGCATC
ACGGCTATACAAAACGCAGAAAACCTTGAGTGTGCTCTAG
TATTGCCATCACAGCAGAGTCATTTCCTCTCGAAGCCTCT
CATCACTGTGTGCAATAGCAAATTCACTTTATAATATTTA
ACTTTTTAAAATGCTTTTTTTATGTAAAAATCTTTTTATA
GAAGTCAAAACAGGTTCATCAAAGCTGTTTTTATACTGCA
TATTCTACCGGGGTGTTGCCATGAAAAATTCACCTGAAGT
GTGGGTGTTAAGTGTTATAAATGTTTGGTTTTCTAACTGT
CTTTTAGACACATTAGGGTATTTTCGTGTATCATTTTTAT
ATATATGTTTGTGTATACTCTTGCGTACAGGCAGTTAAGA
CAATCGAAACATTTGAAGGTGTTTAACCAACCTTTAGCAA
TAGTCATTCTTATGACTTCTACAGGCAGCACCCTGAGAAA
GCACTGTTTTCATGTAGTTTCACCTGTATGATACTGCTGC
ACACAACTGTCAATAAACAGCATTTGATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations