Transcript

si:dkey-5n7.2-201

ID
ZDB-TSCRIPT-090929-3343
Name
si:dkey-5n7.2-201
Previous Names
  • si:dkey-5n7.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016187 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016187|OTTDARG00000013613|ZDB-GENE-050420-254 si:dkey-5n7.2|OTTDARP00000013744 DKEY-5N7.2-001 LG_ BX323837.7 Danio rerio protein_coding NOVEL, 1020 bp
GCCATTTTCAAAATAAAAGCCGCGGTTTTCAAGTTATGAT
GACGTTTGTTATACATTATATTTAGTTACACATTATACTT
GGTTACAAAGCGTTGGTTAATTTAAGTTGACTTTTCTCGT
TAGCAACACGCTAAAGTTTTGTTCACTCGGTCCGAGGGCA
GCGTCTCATGAACAGACAGACAGAAATGTCAGAGCTTGGT
CTAGGACGAAAACGAAGAATTGACATCTGGTCAAACTTCA
CATATGACAACAAGGACAACAAGAGCGTCTGTAAACCATG
TGGAGTAAAAATCGCTGGGAAAAACACCACCAACTTGAAG
CGACATTTACAGACGGCTCATCCAGAAGTCCACACCAAGA
TACAGAAGATGTCTGATGACCATGGGCCAGGTGGAAATAA
AGCTAGTGATGCTACTAGTACAACACAGCAGCAGGCCATC
TCAGATTTCCTAAGGTCTTCAAAGTACAAGACTGAATCAA
AGGAACAACAGACCAAGGAGCAGGCCATAGCTAGATGGAT
TGGATGGACAGGTTTACCACTCACAACAATTGAGGATGAG
GACTTTGTGCTAATGATGGGGATGATAGATGGGAGACTAA
CAGTTCCAAAGAAAACTAAAATTAGCAATTTAATTAAAAC
ACTGTATGAATGCTGTACTTTATCTTGAAAGAATGTCATA
TGCGTTTCATATAATTCAAGGACAATGCATATCTTTTTCA
GGGAACATGTATATTGTTCAGGGAGAGCAGGTCTTGTGGT
TATTTTTTGTGAAAAAGACTCATGTTTTTGACATGTAATA
AAATGTTTTTTATTACAACAATTAGATATGTGCCTGTATT
CTATATATGCTTCCATATATTATATTATACTTACAATTAC
ATGAATTATGGAGAAAAATCTGCTAATATTTGTTCTACTA
AAACTAGACTAAGACTAATAGACTTAAGACTAAACTAAGA
CTAAAACTCTTATGATATTTAGTCAACTAAACTAGACTAA
GACTAAAAGATTTCAGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations