ZFIN ID: ZDB-TSCRIPT-090929-3343
Transcript Name: si:dkey-5n7.2-201
Previous Name: si:dkey-5n7.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016187 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016187|OTTDARG00000013613|ZDB-GENE-050420-254 si:dkey-5n7.2|OTTDARP00000013744 DKEY-5N7.2-001 LG_ BX323837.7 Danio rerio protein_coding NOVEL, 1020 bp
GCCATTTTCAAAATAAAAGCCGCGGTTTTCAAGTTATGAT
GACGTTTGTTATACATTATATTTAGTTACACATTATACTT
GGTTACAAAGCGTTGGTTAATTTAAGTTGACTTTTCTCGT
TAGCAACACGCTAAAGTTTTGTTCACTCGGTCCGAGGGCA
GCGTCTCATGAACAGACAGACAGAAATGTCAGAGCTTGGT
CTAGGACGAAAACGAAGAATTGACATCTGGTCAAACTTCA
CATATGACAACAAGGACAACAAGAGCGTCTGTAAACCATG
TGGAGTAAAAATCGCTGGGAAAAACACCACCAACTTGAAG
CGACATTTACAGACGGCTCATCCAGAAGTCCACACCAAGA
TACAGAAGATGTCTGATGACCATGGGCCAGGTGGAAATAA
AGCTAGTGATGCTACTAGTACAACACAGCAGCAGGCCATC
TCAGATTTCCTAAGGTCTTCAAAGTACAAGACTGAATCAA
AGGAACAACAGACCAAGGAGCAGGCCATAGCTAGATGGAT
TGGATGGACAGGTTTACCACTCACAACAATTGAGGATGAG
GACTTTGTGCTAATGATGGGGATGATAGATGGGAGACTAA
CAGTTCCAAAGAAAACTAAAATTAGCAATTTAATTAAAAC
ACTGTATGAATGCTGTACTTTATCTTGAAAGAATGTCATA
TGCGTTTCATATAATTCAAGGACAATGCATATCTTTTTCA
GGGAACATGTATATTGTTCAGGGAGAGCAGGTCTTGTGGT
TATTTTTTGTGAAAAAGACTCATGTTTTTGACATGTAATA
AAATGTTTTTTATTACAACAATTAGATATGTGCCTGTATT
CTATATATGCTTCCATATATTATATTATACTTACAATTAC
ATGAATTATGGAGAAAAATCTGCTAATATTTGTTCTACTA
AAACTAGACTAAGACTAATAGACTTAAGACTAAACTAAGA
CTAAAACTCTTATGATATTTAGTCAACTAAACTAGACTAA
GACTAAAAGATTTCAGATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-5n7.2-201 Contained in:
[BAC] DKEY-5N7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000016187 (1),  Ensembl_Trans:ENSDART00000170314 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF995878 (1) 758 nt
GenBank:EB832896 (1) 594 nt
CITATIONS (2)