Transcript

zgc:101040-201

ID
ZDB-TSCRIPT-090929-3228
Name
zgc:101040-201
Previous Names
  • zgc:101040-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015877 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015877|OTTDARG00000013372|ZDB-GENE-040801-107 zgc:101040|OTTDARP00000013475 CH211-278N20.7-001 LG_ BX323575.10 Danio rerio protein_coding NOVEL, 1345 bp
GAATCCAATGGATCTAAGAGGGTACTTCAACAGGATTGGG
TTTACTGGCCCATATGACAAACCTGACCTGGATACTTTAC
GCACCATCCACATGCTGCATGTGATGAAAATTCCATTTGA
GAACTTGAGCATCCACTGCGGAGAGAAGAACACGACAGAC
CTGAACATCATCTATCATAAACTGGTGAAAAGCAATCGGG
GAGGCTGGTGTTGTGAAAACAACCTCCTGTTCTCATGGGT
CCTAAAGGAGATGGGTTACAAATACACCACACTAGGCTCT
AAGGTGTTCAACAAGTTCCAAAATGATTTCTATCCCGTTG
ACTCTCACCTCATCAACATGGTAGAGATTGATGGGAAGTT
TTACCTTACAGACGTGAGCTATGGAGTGTCATGCCAACTG
TGGTATCCTTTAGAGATGATCTCGGGTAAAGATCAGCCAC
AGCCTCCCGGAGTATTCCGGCTCCTAAAAGAAGGGGTGAG
GTGGACTCTGGAGAAAACGTCAAGAAAGCAAGTGGTCAAA
GATAAGGCCTATGCTAATTCCAGCCTCATTGACAAGCGCC
TGACGAAAACAATGTACAGCTTCCCGTTGACACCTCGTGC
TAAAGAGCATTTTGTGGATACGCTGGATTGCCTGCAGACT
AGTCCTGATTCTAGATTTGTGCTGAAGTCTATTTGCTCCC
TTCAGTTACCTGAAGGCTTCAGAGCTCTGATCGGGTGGAC
TTACAGTGAGATCACCTACAACCCAGAGGACGACTCTGAC
ATGGTGGAAATGAAGGAAATCCCCAATTGTGACATAGAGA
CTGTGCTGAGGGAGAAGTTTAATGTGGTGTTAGTTAATAA
GCTCACTCCTAAAAACAATAAAGCTAATTATTGCATGTAA
TACTCAACAGAACAGTACAATTTCACACTTTTATTAGTTA
ATATTTAATTTTGATAGTCCCCCTTGATGTTATGTTGACT
ATAAGTAAATTAGCAACTATGAGTCTACTACCTGTCATTA
GAATTTTAGTAGACTGATTAATATCTGCCAACATTTCTTT
TGGCAAGTTAGTCTTACAGGAAATTAAATCAATTGTAACT
TTAGCAATGGGTTTTTGGGGTAGGTCAACCAATGATATGT
TTTTAACATGATAGATCACCTTCCGACTTCAATGTGAAAA
CAATCATAGTCACTTTATATTGAAGTTTCCACTTTAAAGG
GTCTTTGGAATTAAGTATTTTCTAAGGGTACAGCTGATGG
ACACTAAAAGCAAAGTTAATCTGGGGTAATCTGGGGTCAC
CAAACCTGTTCCTGGAGGGCCGGTGAGGCAAGTTGGAGCT
AAACTCTGCAGGGACACCGGCCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations