Transcript

mthfsd-202

ID
ZDB-TSCRIPT-090929-3173
Name
mthfsd-202
Previous Names
  • mthfsd-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015731 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015731|OTTDARG00000013251|ZDB-GENE-030131-3513 mthfsd|OTTDARP00000013356 DKEY-199I24.1-002 LG_ FO834814.1 Danio rerio protein_coding NOVEL, 734 bp
GGGAAACGAAATGGGATGTGCGTCATAAAGTATGGAACTA
CATTGAGGTGAAAAACCTTGCCAATTTTCCACGGCCTGTG
CACAACAGAATTCCCAACTTCAAGGGTGCACTGGAGGCAT
GTAATAAGGTAGCACAATTAGAGATCTTCATCGAAAGTGC
TGTAGTCAAGGTGGATCCTGACAAACCAATGGAGGGGGTT
CGGTTAGCTGCTCTGAAGGCAAGAAAATCCTTACTTGTTC
CAACACCTCGTCTAAGATTTGGGTTATTTAACAGAATAAC
TCCACCAAAAGGTGCAACTAAAGAAACACTGCGTGTTTGT
TCTACTTCTCAGGGTATCAAAGAGTTCAGTGTCCCTGTTG
GTTTAGATGACAAAGTTCAGGTGGATCTTGTCGTAGTTGG
GTCTGTGGCTGTATCTGAAAAAGGTTACAGAATTGGGAAA
GGAGAAGGTTTTGCCGACATGGAATATGCTATGATGGCAT
GCATGGGATCTGTGACTGAATCCACTTGGGTCATTACTGT
TGTTCATGATTGCCAGGTGATGGACATTCCAGAGGAACTC
ATTGAAAGACATGACCTCATGGTTGACTTTATTATAACAG
CAACAAGAGTCATCAAGACTGAATGTAAACACCCTAAACC
ACAAGGCATCATTTGGTCTATGGTATTCATTTATATTTGT
TATCTTTTTTGGGACATTTGCCACTGTGTTACAGTTTTAA
AAGTTTTAGCTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations