ZFIN ID: ZDB-TSCRIPT-090929-3166
Transcript Name: gse1-201
Previous Names: gse1-001, si:dkey-265o13.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015722 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015722|OTTDARG00000013244|ZDB-GENE-030131-9569 gse1|OTTDARP00000013348 gse1-001 LG_none AL935117.16,BX927408.6,BX548023.3 Danio rerio protein_coding KNOWN, 5585 bp
GGCTCCGCTCGGCTCTCCGTCGACGAGTGTGTCAACAATG
TACTGGCGAGCGCTGTGATACGATGGATAAACGCGTCTCC
TTTCCATTTATAAGACGGAAATAGGATTTACCTCTCTTTA
CAGGCATGAGCCATGAGCCAAAGTCACCATCGTTAGGCAT
GATTTCAACGGCGACCCGCACCACGGCGACCGTCAGTCCC
CTCACCCCGTCTCCCCTCAACGGTTCTATTGTGCCCAATG
TCAGTCCTGCCTCTCAGTCCGCCCACTCGGGATTCGCTGC
TGCCCTCCGCAAGCTGGCCAAGCAGGCAGAGGAACCCCGA
GGATCTTCCATCAGCAGCGAGTCGTCTCCTGTCTCATCAC
CGGCCACCAACCACAGCTCTCCAGTCAGTACGCCCAAACG
AGGGCCCATGGGTCCAGTTATAGTGCCTCCTGGGGGTCAC
AGTGTACCCAGTACACCACCTGTGGTCACCATAGCCCCCA
CCAAAACCGTCAACGGCCTGTGGAGGAGTGAAAGCCGGTC
TGTACGAGAGGTTGAATCAGTTCCACATGGAGTCAGTCGG
GACAGGTTAAGTTCAGAAGCTGCTTCTGCCCAAGAGAAGG
GGGGTCCCACTGTCCCAGCACACCTAATTGGAAACCCTTA
CCCATTTGGCTTGACGCCTGCATCTGTGATGCAAGACTCA
CGCTTTCAACCACTTAACCTGCCCCGTCAGATGCCCCATG
CAGTGCCCACGGCCAGTGTTCCTGAGGAATATTTGAGAGG
GTTTCGTCCTTATGCCACTGCTGAGGAGCTCCGTATGCCC
TCCTTGCCACTGGGGCTTGATCCTGCCACTGCTGCAGCTG
CTGCTGCCTACTACCACCCTGGATATCTGCCTCATCCCTC
CTTCTCTCACTACAGAATGGACGATCCATTCTGTCTGTCA
GCGCTGAGGTCGCCATTCTATCAACTGCCTGCAGGAGGTG
CTTTACCTCCTCTACACCCCTCTGCAGTACACATGCACCT
GCCTGGAGTGCGTTACCCTGGAGACCTAAGCCACCCCTCG
CTGTCCAGCCTACAATCTGAGCGCTTGTCCGAACGACTCC
AGATGGAGGATGAGCTGCGACAGAGAGAAAGAGAACGGGA
GCGAGAGCGAGAGAAAGAGAGAGAACGAGAAGCCGAACGA
GAAAAGGAGCGTGAACGAGAAAGGGAGCGAGAGAAGGAGC
TTGAGCGTGAGAGGGAGAGAGAGAGGGAACGAGAGAGGGA
GAAAGAGAGAGAGCGTGAGAGGGAGATGGAGCGACAGAAG
GAGAGGGCAGCACGAGAGAAAGCTGCGGAGAGCCATTATC
TGACTGAGCTTCACGGGCTGAGAGGAGCACCAGACGACAG
AGCCAAACCTGACAGAATCACTAGCAACAGACCTGAAAAA
ACCAAAGAGTCCATTCTTACAACTCCTAAACCCATCCAAC
CTGGAATTCACCAGTCTCTGAACTCCACCCACCATCCTGT
GCCCAGTCTCTCCTCTGCTCATGGTTTGTATCTGGGCCCT
GGAGGGGCAGGACCCACCAGCTTGACGGTGGCCACAATGC
TACAGCGTACTGAGGAAGAGCGCTGGTTGGCACGGCAACG
TAAGCTACGGCAAGAGAAGGAGGACAGGCAGTACCAAGTG
TCAGAGTTCCGACAGCAGGTCCTAGAGCAGCACCTAGACC
TGGGCAGACAGGGGGAAATTCCAGACATGAATGTAGAAGG
ACACAGACCTGTACCAAACCATCATGAGCCAAGCAGCAGA
GATCGTGACAGAGACAGAGATTCTCATCCACTCCTGGGAG
CTCCACCTCCTCTTATCTCCCCTAAACATCAGCACAAAGA
CCATGCGCCCCCACCACCGACCACCCTCTGGAACCCTGCA
GCACTCATCGAGACCTCTACTGACTCTAGACGCACCTTGC
ATGACCCTCCGAGTCTGGGTCATTACGATATCAGCCGGCT
TCCCCTGCCCCCCTCCAAACACGAACGCCATTACAACTCT
GAAAAGCTGGAAGAAGGATCCCGGAAGAGAGACAGTCTGG
ATAAATACCCTCCTATTCGACCAAGTGGATTCTCTGAGCC
AAACACTTTCCTAGCAGAGCTGGAAAAATCCACCCAGAGC
TTCCTAAACCAGCAAAGGGCACCGTTGAGTCTGTCAGGAC
CCTACGGAGAGCTGAGCGCTGGCTTTAAGTCCAGCGGACC
TTTAAAGAACCTTCAGGGGCATTCACGTCTCGCGCCGGAT
ACAACGTTAGTTTATGACGAGTTCCTGCAGCAGCATAGAC
GAGCGGTCAGCAAACTGGACCTAGAGGAGAGAAGACGCAG
GGAAGCCAGAGAGAAAGGTTATTACTATGAGCTGGACGAC
TCCTATGATGAGAGTGATGAGGAAGAGGTGCGAGCTCATC
TCCGGAGGGTTTCTGAACAACCACCGCTCAAGCTGGATGA
TTCCACAGAGAAAGTGGAGTTTTTAGAGATGTTTGACCTG
ACTACCCTGGCCCATCGAGAGGAGATGATGGAGGTGAAAA
GGAAAAAAAGGAGGCGCATGCTAAGAGAGAGGAGTCCCTC
CCCACCAACTGTGCAGAACAAGCGGCCCACTCCTACACCC
CTACTAACCCGTTTCACTCCAGAGGACATGAACAACAGCC
CAGAGCTAGAAGACAAGAAACGTTTCCTCACCATCTTCAG
CCTCAACCACATCACACAGCAGCAGAGAAGAGATAACGAG
AGGGTTGAGGAGTTGTTGCAGGCCATAAAACAGAAGAGTG
TGACTCTAGACACCATCAGACACAACCCTCACCCGCTTTG
CAGAAGTCCTGCAGCCCATAGCTCAGACCAGTCATCTCAG
TCTCCAGTCCAGTCTGAAGAACTGCTGAATGGATGGCCGC
TCAGTCCATCGCCGTCTGTGTCTATTCCACAGCCTTCAGC
AGACCCTCTCTCCATCTCAGATCAGCACAGACCTCTCTCA
GACCCCCCGAAACCTAAAGACTCTTCCTTGCCTCCTGCAT
TACCTGACAAATGTCGAGCCAATGACAGCCTCCCGGGCAA
GAGCTCCAGTCTGCTGAATAGTCTCCGACAGCCCCCATTT
GCTAAAGAAAGTTCTGTCAGTGTCAACGGAAAGACTAAAC
CCTGGGAGAACTTCATTGCTGAGGAGTTTGCCCAGCAGTT
CCATGAATCTGTACTGCAGTCCACACAAAAAGCACTGCAG
AAGAGTAAAGGTGGTGCATTGGTCGTATTGGAACAAAACC
ATGCGGTGGACTCATCCGTGCATTATAACATTCCTGAGCT
CCAGAGCACACCAGGCCGCTCCAAACCCCACCCACACCCT
CCCTCATCTCAGCCCAACGGACAGCACTGCCCCCCACAGC
CCTCTCGTCAAGAGCTTTCTGCAGAGGAATCTGAGGAAGA
AGAAGAGGAAGACGACACTGAGGAGGATGAGCCCTCGACG
TCCAGATGGCAGGGCATTGAAGCCATCTTTGAAGCTTATC
AAGAGTATGCAGAAGAGCAAAGCATTGAACGCCAGGTTCT
TCACAGTCAGTGCAGACGACTGGAAGCACATCACTATAAT
CTCAGTCTAACCGCTGAACAGCTCTCACACTCAATGGGGG
AGCTGATGGCTCAGAAGCAGAAGCTGGCAGCAGAGAGGGA
GAACCTGCAGGCAGAACTGGAGCACTTTAAAAAGTGTTTG
ACGCTGCCACAGAGCCCCTGGTCTAGGGCTCACTTTAAGG
GCTACCCACCCAGGTGACACCCTATGGGACCACTGACCAC
CACCCCCCAATGTCCCTTCCAAACCCCCAACACCCAGACT
CATACTCCATCCTAGAGATGGTGAGGAACAGTAGATCTGG
CCATTGAGTTTTTCCTCCCTCTGACGCCCTCCTGTGGGAA
AAACCATGCATGAGCACGTCAAAGCCTCCCAATGCATCCA
TCTCACAAAGACAACAGCCATAGCGCATCACAGCGAGAGG
AAGAACGCCAGTCAAAACACACATCCACACACCTGCAATC
TTCTTTACCATGGAGGTCATGCCTAGAAATGCACTTAAAG
ACATGAAAGGAAAAAAAACCTGAAGAACTGTCTGTGTTCT
GACAGACTCTTTTAAATCTTGGGAAGGAAAACGCATCAGA
TGGATTAAAAAAAAGAAAGAAAATTTTTATTTCAAGATTT
AGAATAAAGTTTTTTAAAGAGGTGCTTCAGCATTGTATTG
TAAATAATTTCAAAACAAGAAAAAAGAATTTTGTATGTTT
TTAATTACTTAAAAGCGTCGTTCTTTGGAAGAAGAAGAAA
AAAAAGCCTGCCATTTTGTTTTCTAATATATTCATGTTTT
GGGGGGCGTGAAGCAAAAGGTTCACTTTCAGCGTTTGCTC
TGCTGCTGGTCAGATTAACTTTTTCAGGACTCGTGGAGTG
ATGACATCACTTCCTTTCTGCCTGAATTACAGTAGCAATG
ACACGGGACCTACCGCCAACACTTTTCTTCTTATCCCATA
AGGCCATGTAATCATTGGATAACTTTAGCCCTGCATTCTG
ATGACATATATGTGTTTGTGACACAGGAAATCTCTACGTG
ATCACCTGTCTCTCAACGTTCTGGACTGCTACACGAGTTG
TTTTAGTGGCGAAGCAGCATGCAGCCTCTTTGCTTTTCCG
ATTCCTGCATTCAGTTAAAGGGGCGCTTAATCCAAAATCT
GCGTCAGAGGAATTGACATGCTCAAAAAGTAAATCCTAAG
AAAAAAATACAATTCGTTTGATAAACAAAACAGTTTTGCC
ATTGACAATTAATGTGCCAAAGTCTGAGGTGGTGGCATGC
CAAAAACAGAAACAAGTCAAGAAACAAGAATTGAGTCAGT
CCTGCTGTCAGACACAATTGGAAACCATCCAAAGAAATCT
GCCTCTCTGAACACGTTCTTGTTTGCCAAGTTATTTTTTT
TATATAATACCCATGGCTAATCAATCACATTTTCTCATCC
CACAAGTCACTGACGAAAATCATCAATATGGGCCTTAACA
TGTATGAACTCTGACTGCCTGTAATAGCTTTTCTTTTCTA
CCTTTTTGTACTGTTCTGTTAGATGTAGAAGCTGGAATGA
CACACCTGTTTGTTTCCTGGCACTTACCCCTACCCTTCAT
ATGTGTGTATGGCACAGCACGCAGTTACAAATCAACCACA
CACACACACACACTCGCGCTATTTCTGATCTGAATTCACT
GCAAGGGTGAAACATCTCGAATGCATCTTCATGAAGCACA
GGTGAGGTGTTTGCTTGCACTGTTGTTTATTTCAGCCATG
CGGACCCCGAGCAGGTGTGCCATCAGTTTGATCATTGTGT
GTGTAAATCTGCATCACATGAAGTACTACCACTGCCCAAC
ACACACACACACACACACACGCATATATACACTCGCCCTG
AAACTCAGTGGAGGACGTTAGATGCTGTGAAACCATGTTT
TTGTTTTTCTATTTTCTTCTTTTTTTTTTATGTACTTGTT
TGAATCCATTGTAATGTAATATATTCTTTGTTGAGTGTAG
TAATTAGGTATTTATGGATATATTGCTGTAATTTCAGACA
AAAAATTAAATATTTCAAAAATGTC

gse1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gse1-201 5585
gse1-202 (1)    Ensembl 5719
gse1-204 (1)    Ensembl 8119
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gse1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000015722 (1),  Ensembl_Trans:ENSDART00000140908 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD595395 (1) 650 bp
GenBank:AW420134 (1) 645 bp
GenBank:BI326007 (1) 514 bp
GenBank:AL923232 (1) 391 bp
GenBank:AW420840 (1) 368 bp
GenBank:EB779491 (1) 312 bp
CITATIONS (2)