Transcript

nr2f2-204

ID
ZDB-TSCRIPT-090929-3141
Name
nr2f2-204
Previous Names
  • nr2f2-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015639 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015639|OTTDARG00000013199|ZDB-GENE-990415-252 nr2f2|OTTDARP00000013295 nr2f2-003 LG_none BX936364.6,BX569787.4 Danio rerio protein_coding KNOWN, 419 bp
TGACGGCCTCTCAGGTTGCCCCTCCGACCCCTCAGACACC
CGTTCAAGGACCCCCGAACAACAATAACAACACACAGTCA
ACCCCGACGAACCAGACGACGCAGAGCCAGTCGGAAAAGC
AGCAGCCACAGCATATAGAGTGCGTGGTTTGCGGGGACAA
ATCCAGCGGTAAACACTATGGCCAGTTCACTTGCGAGGGG
TGCAAAAGCTTTTTCAAACGGAGCGTACGAAGGAACCTCA
CTTACACATGCCGTGCCAACAGGAATTGTCCCATTGACCA
GCACCATCGCAATCAGTGTCAGTACTGCCGCCTCAAAAAA
TGCCTCAAAGTTGGCATGAGACGGGAAGTTTCTCTTTTTA
CTGCAGCCGTGCAAAGGGGACGAATGCCACCCACACAGCC
ACACCATGGTCAGTTCGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations