Transcript

pskh1-201

ID
ZDB-TSCRIPT-090929-3076
Name
pskh1-201
Previous Names
  • pskh1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015354 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015354|OTTDARG00000012963|ZDB-GENE-050119-1 pskh1|OTTDARP00000013033 CH211-201B11.4-001 LG_ BX548157.5 Danio rerio protein_coding KNOWN, 5380 bp
GCAGGGGTCGAAGCAAGCGGAGGTCTTTCCTTTCCCAAAA
GGAAAAAAAGGAGAAGGGGGAGAAAGAAAGAAAGGTCTAC
ACAGGAAAAAAGGTGGTCCCACTCCGAAAACACCGTTTCC
AAGCAGGCGGTCTCAATTTCATACTTTTCTTTTCGTATCG
CCTCGTTTCCGAAGTGATACAAACACTTTAACAACCCTTA
TTTTGGACTGAATATCTTTGTTTTTGCAAATACTAAAGGG
ATGCTGTTTTTAACCGAATTAAAGTTTTAGAAATGCGGTG
AAGTGAAGGGAAGAGCTGTAACTGGGGTGAGGAGGCTGGC
GCTGGGAATCTTGCCTTTCTACTCCCACCATCGCCAATAA
GAAAATACACTGTTAAGATTATTATCCATAAATTTCTCAT
TGATTGGAGTTCAGTTAATTTTGGAGGATTGATTGGAGAG
GTTACTATAGTGTTTGACTGGACGTATCCTCTCGTGGCAT
TTGCCGGTGTGGCACTGCACCGTGCACCGTTTGGATGTTG
CCTGGGAGATGAGGATGTGCTGCTGGCACCAGGAAGGTCG
GAATTTGACGTGATGGGGTGCAGGACAAGCAAAGTCCTCC
CAGAACCACCCGGTGACGTCCAACTTGACCTGGTCAAAAA
GGTAGAGCCGCATCAGACGGATGTCTACAAAAACTTCATC
AAATACGATGGTGGTGGGGAGAAAACAGGCTCGCCGTCCC
CTCAGGGTCAAAGCCAGGCTGTTGCAAAGGTGAGCCAATC
CCCTCCACCGGCTAATGACCAGCCAGAACCTGCTGACTCA
CACCGGAAGAAAGTAGCCAAATACAGAGCCAAATTTGACC
CTCGAGTGACTGCCAAGTATGACATTAAAGCTTTGATAGG
TCGGGGCAGTTTCAGTCGGGTAGTACGAGTGGAACACAGG
AGCACACGGCAGCCATATGCCATTAAGATGATCGAGACGC
GCTACCGTGAAGGCAGAGAAGTATGTGAATCTGAACTTTG
CGTCCTACGACGTGTGCGCCACACTAATATTATCCAGCTA
ATGGAGGTGTTTGAGACGGCTGAGCGGGTCTACATGGTGA
TGGAGTTGGCCACTGGTGGAGAGCTGTTCGACCGCATCAT
CACCCGTGGGTCTTTCACAGAAAGGGACGCCACACGGGTG
CTTCAGATGGTTCTTGATGGGGTGAAGTACCTCCATACAT
TGGGCATCACGCACAGGGACTTAAAGCCGGAAAACTTGCT
TTACTACCATCCTGGTGCTGATTCCAAGATTATGATCACA
GACTTTGGCTTGGCCAGCACACGAAAGAAAGGGGACGAAT
GTTTGATGAAGACTACCTGTGGAACACCTGAGTACATCGC
TCCCGAGATACTCGTTCGCAAACCATACACTAATGCAGTA
GATATGTGGGCACTGGGTGTCATTTCCTACATCCTGCTCA
GTGGAACCATGCCTTTTGAGGATGACAATCGAATGCGTCT
GTATCGACAGATCCTCAAAGGAAAATACAGCTTCTCTGGG
GAGCCATGGCCAAGTGTTTCCAATCTGGCAAAGGACTTCA
TCGATCGCGTCCTCACGGTGGATCCTAATGAGCGGCTCTC
TGCGGGCCAGGCACTCAAACACCCCTGGATTGTAAGTATG
GCAGCTTCCTCCTCCATGAAGAATCTGCACCGGTCCATTT
CCCAGAATCTCCTGAAGAGAGCTTCGTCACGCTGCCACAG
CACAAAATCATCCCAGTCCACTCGCTCCAGCCGCTCCACC
AAGTCCAGCAAGGCACGACGCCTTCGTGAAAAAGAGCTGC
GAGAGCTGAACCGCCGGTACCAGCAGCAGTGCAATGGTTA
AGAGGAAATAAGACAGCTTTTACTTTAGGAAAAACAGTGG
AGAGAGCGGAACAACTTCCTGCTCCGTCACCACAGAGCCA
ATTAGCAGAAAGCCTCCTTCTAAAACTTCCCTCGTTTTCT
ATTTTTCTGCTGTCTCTTTCTTGTTTATTACCTTTTATGT
GAGTGTTTTATTTATTTATTGCTGGTGTATTTTCATGTTC
GTATTGTCCTTGAAAATTATCTCATTCAGCATTTTACATG
ATTGTATCTGTTGAACAGAATTTTACAAACGTCGCTGGAA
GGACTAAGAATATACCTTCCTGATTTTGCTGTGAATTATT
TTGTTATGGTACCCAGTCAGAAGATCGCTCTTCTGATGGG
GGAAATGTGCTGTTTATTCATTATTACCAACAAATCACTA
GACATATTGGTAGTTTTTTTCTTACCTTAACGTTACTTTG
AACATGAGGGACGGTTAGGATACAACCATTGGTAACTGCA
GGTCACATTTAGAATCAGTCTGCTGTTTAAATATAATAAT
GAGCCTTGATGGGATAGATTGGCAAAAAATGGAGATGTCT
CTATCATTTACTCAGCCTTACTTTGTTCCAGTTTTGCAAA
AGTGGCCTTAATGAACCATTTTGACACAAAAATCTTCATT
TTGTAATCTTGTTTTGCCTCGGAAATATGTTAAGAACATT
TTTTTTTTTTTTAAATTTTGGGACACTTTGATAACTACAG
AGACAATAGCCATGCTTTTGGTCTTCTCGCATTCTCTCTT
ATATAAGCTTGTCTTGGACTATTAGTATTTCTCTTTTTGG
TTAAATTTATTAGGTAAATTATTGTAAAGTCTGTGAAACA
TTCTTTTGTCAAAGAGTAGTTAAAAACAACTAAATTTGAA
GTTACTTGAGGGTCCATATGTGAGTGTTAAGGCTGCCATA
CATTATTTGTTATTTTATTTCTACAAAATTAACTAAAATA
ATCAAAAAGGATGTTTGAAAGACCACTGTGTACATTTGCA
GCCCTTTTTTCCTTTCTAAAAGGAAAGTTAAATGCGTTAA
ATGCTCATTAAACTAAGTTAAACAGGTTTGGAACTGTATG
AAGCTGAGTAAATGATTACATGAAAAATGGCAGTTAATTT
TCTCAACCCTAGGCTATTCAAGATGTACTATGACTTTTCT
TTGGTAGAAATACAATACCTGTGGTTCCTGATGATGCATA
GAGATTTTGTGGAGCAAAACTACTCACAACATTACATTAC
ATTGCATTATACCATGTGGGTGCAAACTCCAATGTGAGCC
AATGTTGTGTGTTTACAATGGAAAAGGAGGACATGTATTG
TGTTGTTCATCAAATTGGTCCACGATTTTGCTTAACCTGG
ATGCTGCAACCACCATAAAATAGTAAGATTGGTGTATCAT
TAGTGAGACACCAATCACTATAATAGTATATAATAGTGTT
TAACAGTTTACCAAGGACCACAATTTAAGCTAAAGATAAT
ATTTAATGTTCTAATAAAGAAAAAAAAAAACTTGGATGGG
CTGAGAACGAGTACTTTAACTGTACATTTTCAGTTTTCGA
TGAACTATATCTTTAATTTGGTCCAAAAATATCAAGGAGC
TCTACATTCTGCACAATATGTGTGTTATTTATCCTAAATA
AGACACATTATAAGAACCAAAAATGGTAGTATTAGTTGTT
AATACCTGTCAAAAACATTTCAAATCATCTTGAGACTTGA
CTTTAAATCAGGGGTGTCAAACTCAATTCCTGGAGGGCCG
CAACACTGTAGAGTTTGGTTCCAGCCCTGCTTCAACACAG
CTATCTGTAGGTATCAAACAAGCCTAAAGCACTTAATTAG
TTTGATCAAGTGTGTTTAATTAGGGTTGGAACTAAACTGT
GCTGAGCTGCAGCTTTCCAGGAACTGAATTTGACACCTGT
GCTTTAAAGAATTCGTTTACCAACCTGCACACTCAAACTT
CTATCATGATTTACTCACCCCAAAGTTGTTCCAAACTGAA
AAAAATAAATAAATTCGTCTTCGTAACACAAATTAATATG
TTTAAACCAATATTGTGTCCCACCATTGAAACTCTGACCA
ATATGAAGCAGTTTAATCCAAGTCTTCGGAAAAATCATGA
TCACTATATATAATGAGCACATTGTAGTCCTTTATTAACA
TATAAAGAACCTGTTTGACATACAATAACAAACCTCATTG
GATCTTGTGTAAGCTCGAAGATGTCATGTGACAATCAAAA
ACGAACCTTGTTGGTTCTCTCATGTCAAGCAAGCATTCCA
GAGCTTCCATAACCAAATTTGAAAGTAGTAAACACTGCTT
GCTGATCAGTGTTTATATTCGAATAAATTTAATTAAACCT
GTTCAATTTAGAAAGGGATTGCGTCTCTTATTTTTAATCT
CTATGAATGTTTTAAAGCATCAGAGTTTGAGTGAACTGAC
TTTCAGCGGAGTCACAATTAGATTTAATTAAAAATGGCAT
TAACACTTTACAATAAGGTTTCAGTAGTTAATGAATTTAC
AAACAAATGATGAACAAAAAAATATTATTTTAATTCCCAG
GTTCTGCTGGTTGAGTTTTACAAATTTTCATTGCCAATCT
TAAGCCAATTGTGATCATTTGTATTGGGTCAATTTGGAAT
TTCCCCAACCATTGCAGAGCGCGGAGGACCAAAGTGAGTG
CTCCGACTTGGCCCCACCCTGGTCCCGATGAACAATACAT
TTATTACAGTGTGTATTCATCTTTGTCAATGTTACTTAAT
GAAAATAAATTCACTCTTTGTTAGTTCTCATTACCTCACA
GTTCATTATGTTAACAAACACAATTTGAATTTTAATAATG
CGTCAGTAAATTTAAAACTATAATTAATAAATTCCGTACA
ATTATTGTTCATTCTTGGTTTATGTCAGTAAATACATTAC
CTTAAATTAATGAAACCTTAATGTAAAGTGTGACTAAAAT
ATCTATATTTGTGCTTCGAACGTGAAGGTAAAACAACATG
AAGGTCAACCGATTCAATTTTGGGGTGAACTAACCTTCGA
AAAAGACACAAAAATACAGTGTAGCCAAATGGGCTATTGA
TTTAGTCTTTAAATGTGGTCGGTGAAGAAACCTGCAGTGA
TTCTTGACTTCTGCAGTTGGATCTGCCTGTACATGTATTG
CAGTAATTAATAACTGATGCTGATTGCTTTCTCAGTATGG
GCGGCCAGTATTGGAAAGCCCTGAATCACAATCGGTTGCT
TTCTCTGCCACCAGCTGTTGTTTCTTGAGCAAGACACTGA
ACACCATGAAGGCCTTTTGGCAGATTCTCACTCTTTCCCC
CCCTGTCAGAAACCAGCAGCGATGTACCAAAGAAATTCCT
GTGTGCCTGATGTATTAACAAGGAACATTTGGTGAGATCT
GACATATGATTCCTCACGAAAATAATTACTGATAAAACTG
TGATGATATGAAGATTTCTCAAAATGTGTTCTTAGATCTG
TTTTTTATGTTTGTTTTTTTTATATAAAAGTGTATATCAA
AAATTAAAGAGGAAAGGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations