Transcript

ccdc80-201

ID
ZDB-TSCRIPT-090929-3
Name
ccdc80-201
Previous Names
  • ccdc80-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001378 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001378|OTTDARG00000001278|ZDB-GENE-030616-56 ccdc80|OTTDARP00000001216 RP71-20I5.2-001 LG_ AL590146.2 Danio rerio protein_coding NOVEL, 2604 bp
ATGAGGGCACGGTATATGCTTGGTTTCGGTGTTTTGTGTC
TGTTGACATGGGCTGTTTACGTGTCAGAAAGCAGCCCGAC
CGATAAACAGGCTAAACTCAGACTGATGTCCGTACGACGA
GCAAGACAAAACAAATCCCGACAGGGTCAGATCATTAAAA
CACGTGCTTCTTCTACATGGATCAATGATAAACGCCAACA
GATGCAGGGAGACGAAGGTGTACAATTTAGAAGGAATGTC
CAATCCAGAAAGGTCTTGGCACAAAGGAGACCAGCACAGG
GTGGGACAAGGAATCCAATCCAGCAAGATGATGGAACACC
TGGAGCCAGGGCCAGAGTGTCCCGCATGCCAAGCAGTGCT
GGTTCTCCAAACCTACTGGCGTCATTTGCAGGGAAAAACC
GCCTACTGGTTATTTCCGCACCTCACGACTCTGATGGCTA
CTACAGATTGATGATGAGTCTGCTTAAACCTGAGGTTTAC
TGTGAGTTGGCTGAGCGGCACGTGCACCAGATTGTCATGT
TCCATCAGGAAGGAGAGTTGGGTGGGAAAATCAGACGCAT
TACTAATGAAGGGAAAGTGATGGAAGAGCCATTAGATACT
GCTCTCATTCCCAGGCTCATGACCTTTCTAAAATTAGAGA
AAGGAAAGTTTGGGATGGTTCTTCTTAAGAAGACGCTTCA
GGTGGAGGAACGGTATCCATACCCGGTCCGACTGGAAGCA
ATGTATGAAGTTATCGACCAGTCACCTATGCGCAAAATGG
AAAAAGTACGGCAGAAAGGCTTTGTGCAGAAGTGTAAAGG
GGCTGGGGTGGAGGGTCAGGTGGTTGAGGGTGTCCTGACC
ACTGATTCCCAGGTGGACCCACCAACAGAAAGGAGAAAAG
AGATTCGGAAACCCATTCGAAGACCAACAACAACTACCAC
TCCAGCTCCAACAAGACCAACAACTACCACCACCACTACC
AAAGCAACTACTACCACCACAACACGTCCCCCAACTACAA
CCCGATCTACCACCACCACAACAACAACGACAACAACAAC
AACGCGGCCAACCACAACAACAACACGGACCACCACCACT
CCAAGGACTACCAGAGCTAATACTACCCCTCAATGGATCC
CAGCCCACAAGACCACTGCCGAACCTTACTATTACAATCG
TAGGGACAGATACCAGACCACCTCACCCCCAACTGACTCA
GCAAGATACAGAGACAACCACACTTCTAAAAAAGAATACA
ACCATAGACATACCAACACTATACCAACACAACACAAGCC
AACTAAAGTAAGGCCTACAAAGAAAAAGAATGGCGATAAA
GATATTAGCAACGCGTATGAGGAGAAATATGACGTAGGTG
TGCCTACCGATGCCTATCCTGAAGAAAAAGAGGAAGAAAT
CGTGCCCACCAAAAGAGGCAAGGGCAAAACAGATAAAAAG
AAGAAAAAGGACAAGACAGATAAGCTGTCTAAAAAGGACA
AAGCAGAGAGGAGAGGAAAAGATGGAAAGGGTGGTAAGAA
AAATGGAAAGAAAGTTCCAAAGATTCTTGAGAAAGAAGAT
TATCAGAAACCAACAAAAAGACCACCACCGCCACCGCCAC
CTAAAGGAACTCTGGCAACCTTTTTGGACTATTTTGAAAG
CAGGAGGAGATTAATTTTGATCACCTCTCCAACAGAGGAG
AACAGCATGTATATTCAGCAGAGGGATGAATACTTGGAGC
ACGTGTGTGAAATGGCAATCAGGAAAGTAACCATCATCAC
CATCTTTGGCACATTTAGGAATAGCACCATGAAAATTGAT
CATTACCAGCTTGAGAAGGACAAGCCCATGAAAGGTCTGA
GACAGGAGGATTTGGAGAACCAGGATCTCATCATGGAGCT
GAGGAAAGAGTACGGAATGACCTACAACGATTTCTACGTG
GTCCTCACAGATCTGGACATGAAGGCGAAGCAATACTATG
AAGTGCCAATTGCAATGAAGGCTGTGTTCGACTACATCGA
CACGTTTTCATCACGTATCAGAGAGATGGAGCAACAGAAG
AGGGATGGGGTGACGTGCAAAAAAGAAGACAAGCCCAGAT
CATTGGAGAACTTCCTTTCCAGATTCCGCTGGAGACGCAG
GTTGTTTGTCATATCTGCACCAAACGATGAGGAATGGGCC
TATCAGCAACAGCTTTATGCACTGACCAGTCAGGCCTGCA
ACCTGGGTCTTCGTCATGTGTCCGTGCTGAAGCTGGTCGG
TACAGACCTGTTAGACATGGGAGGAGTGTTAGAGCTTTAC
CCCATCAACGGTAGTGCAACGGTGGAGCGTGAGGGTATCT
CTGCCACTCTAGTAAGAGACATCAGAAACTACTTCCAGAT
CAGCCCCGAGTACTTTTCCATGCTGCTGGTTGGAAAAGAC
GGAAATGTCAAATCCTGGTACCCGTCACCCATGTGGTCCA
TGGCCATCATCTATGACCTGATCGACTCCATGCAGCTCCG
CAGACAGGAAATGGCCATCCAGCAGTCTCTAGGTATGCGC
TGCCCTGAGGATGAGTACGGTGGATATGGTTATCATCATC
ATGAGGGTTACCAGGAAGGTTATCATCAGGGTTATGGATA
TTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations